Transcript: Mouse NM_009097.5

Mus musculus ribosomal protein S6 kinase polypeptide 1 (Rps6ka1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Rps6ka1 (20111)
Length:
3151
CDS:
166..2373

Additional Resources:

NCBI RefSeq record:
NM_009097.5
NBCI Gene record:
Rps6ka1 (20111)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009097.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285729 CAGTGACGGCTACGTAGTAAA pLKO_005 1407 CDS 100% 13.200 18.480 N Rps6ka1 n/a
2 TRCN0000022826 GCACAGCTTGGGCATTATTTA pLKO.1 699 CDS 100% 15.000 12.000 N Rps6ka1 n/a
3 TRCN0000285730 GCACAGCTTGGGCATTATTTA pLKO_005 699 CDS 100% 15.000 12.000 N Rps6ka1 n/a
4 TRCN0000022827 CTACATACTCTGCTCTCAATA pLKO.1 2264 CDS 100% 13.200 10.560 N Rps6ka1 n/a
5 TRCN0000274674 CTACATACTCTGCTCTCAATA pLKO_005 2264 CDS 100% 13.200 10.560 N Rps6ka1 n/a
6 TRCN0000274655 GGCGTCATCTCCCATGAATTT pLKO_005 2588 3UTR 100% 13.200 9.240 N Rps6ka1 n/a
7 TRCN0000022828 CAGAGGAAATTAAGAGACATA pLKO.1 1100 CDS 100% 4.950 3.465 N Rps6ka1 n/a
8 TRCN0000022824 GCTCTATCTTATTCTGGACTT pLKO.1 573 CDS 100% 4.050 2.835 N Rps6ka1 n/a
9 TRCN0000274654 GCTCTATCTTATTCTGGACTT pLKO_005 573 CDS 100% 4.050 2.835 N Rps6ka1 n/a
10 TRCN0000022825 GATCAGCAAGACTGTGGAATA pLKO.1 1719 CDS 100% 10.800 6.480 N Rps6ka1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009097.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06896 pDONR223 100% 91% 98.5% None (many diffs) n/a
2 ccsbBroadEn_14830 pDONR223 0% 91% 98.5% None (many diffs) n/a
3 ccsbBroad304_14830 pLX_304 0% 91% 98.5% V5 (many diffs) n/a
4 TRCN0000470979 ACTGACTTTTCCCCTTGCATTGCC pLX_317 19.1% 91% 98.5% V5 (many diffs) n/a
5 TRCN0000492141 TTCACCAAATGGCCTGTTCCTGCA pLX_317 14% 91% 98.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000487686 GCTTCCTAGCCATACGCAGCGCCA pLX_317 10% 90.9% 98.3% V5 (many diffs) n/a
Download CSV