Transcript: Mouse NM_009182.3

Mus musculus ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 (St8sia3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
St8sia3 (20451)
Length:
6306
CDS:
790..1932

Additional Resources:

NCBI RefSeq record:
NM_009182.3
NBCI Gene record:
St8sia3 (20451)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009182.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415351 TCTTCAGCATGTCGATGTAAT pLKO_005 1101 CDS 100% 13.200 18.480 N ST8SIA3 n/a
2 TRCN0000093995 GCCCATTATGAATAAGCGTTA pLKO.1 1245 CDS 100% 4.050 5.670 N St8sia3 n/a
3 TRCN0000093994 CCCTTGAGTTAAGAAACATTT pLKO.1 5698 3UTR 100% 13.200 10.560 N St8sia3 n/a
4 TRCN0000093997 GCATTATGATTATTCCAGCCA pLKO.1 1170 CDS 100% 0.660 0.528 N St8sia3 n/a
5 TRCN0000093996 GACCAGTCATTTGTGCCCATT pLKO.1 994 CDS 100% 4.050 2.835 N St8sia3 n/a
6 TRCN0000093998 GCAACTGTAACGAGAACGCTA pLKO.1 1549 CDS 100% 2.640 1.848 N St8sia3 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2434 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009182.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03184 pDONR223 100% 92.2% 97.8% None (many diffs) n/a
2 ccsbBroad304_03184 pLX_304 0% 92.2% 97.8% V5 (many diffs) n/a
3 TRCN0000477880 CGATATCTGTCACGTCTTCTCTTC pLX_317 31.1% 92.2% 97.8% V5 (many diffs) n/a
Download CSV