Transcript: Mouse NM_009703.2

Mus musculus Araf proto-oncogene, serine/threonine kinase (Araf), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Araf (11836)
Length:
2405
CDS:
138..1952

Additional Resources:

NCBI RefSeq record:
NM_009703.2
NBCI Gene record:
Araf (11836)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009703.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022609 CACGCCAAGAACATCATTCAT pLKO.1 1392 CDS 100% 5.625 7.875 N Araf n/a
2 TRCN0000054915 CATGGCGATGTAGCTGTGAAA pLKO.1 1119 CDS 100% 4.950 6.930 N Araf n/a
3 TRCN0000054914 CTGCGTTGACATGAGTACCAA pLKO.1 566 CDS 100% 3.000 4.200 N Araf n/a
4 TRCN0000287252 CTGCGTTGACATGAGTACCAA pLKO_005 566 CDS 100% 3.000 4.200 N Araf n/a
5 TRCN0000199465 GCAGCTGAGGTGATCCGTATG pLKO.1 1551 CDS 100% 2.000 2.800 N ARAF n/a
6 TRCN0000315028 GCAGCTGAGGTGATCCGTATG pLKO_005 1551 CDS 100% 2.000 2.800 N ARAF n/a
7 TRCN0000054917 CCTAAAGTCCAACAATATCTT pLKO.1 1418 CDS 100% 5.625 4.500 N Araf n/a
8 TRCN0000054916 CTGTCAAAGTGTACCTGCCTA pLKO.1 196 CDS 100% 2.640 2.112 N Araf n/a
9 TRCN0000294820 TCTCCTGCTTTCTCCATAATT pLKO_005 2107 3UTR 100% 15.000 10.500 N Araf n/a
10 TRCN0000294819 AGACACGGCATGTCAACATTT pLKO_005 1210 CDS 100% 13.200 9.240 N Araf n/a
11 TRCN0000022610 CAGGCTCATCAAAGGAAGAAA pLKO.1 323 CDS 100% 5.625 3.938 N Araf n/a
12 TRCN0000307404 CAGGCTCATCAAAGGAAGAAA pLKO_005 323 CDS 100% 5.625 3.938 N Araf n/a
13 TRCN0000022612 GCATGAGTGTCTATGACTCTT pLKO.1 250 CDS 100% 4.950 3.465 N Araf n/a
14 TRCN0000294818 GCATGAGTGTCTATGACTCTT pLKO_005 250 CDS 100% 4.950 3.465 N Araf n/a
15 TRCN0000054913 GCCTATGGTGTTGTGCTCTAT pLKO.1 1611 CDS 100% 4.950 3.465 N Araf n/a
16 TRCN0000022611 CAGTCGGATGTCTATGCCTAT pLKO.1 1596 CDS 100% 4.050 2.835 N Araf n/a
17 TRCN0000022613 GCAGTTTACTGCTCAGAGCTT pLKO.1 833 CDS 100% 2.640 1.848 N Araf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009703.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15358 pDONR223 0% 89.9% 95.2% None (many diffs) n/a
2 ccsbBroad304_15358 pLX_304 0% 89.9% 95.2% V5 (many diffs) n/a
3 TRCN0000466363 CCTGGGTTTACAGATGTGGCTTAC pLX_317 12.9% 89.9% 95.2% V5 (many diffs) n/a
4 ccsbBroadEn_14544 pDONR223 0% 89.9% 95.2% None (many diffs) n/a
5 ccsbBroad304_14544 pLX_304 34.2% 89.9% 95.2% V5 (many diffs) n/a
6 TRCN0000466438 TTAATCGCAATTCTTCAACCCGCT pLX_317 18.8% 89.9% 95.2% V5 (many diffs) n/a
7 TRCN0000487716 TACTCTTTCGACAGCCAACCCGGG pLX_317 13% 89.9% 95.2% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_13813 pDONR223 100% 89.4% 94.5% None (many diffs) n/a
9 ccsbBroad304_13813 pLX_304 0% 89.4% 94.5% V5 (many diffs) n/a
10 TRCN0000481643 GATAACGTGACCGCTAGGGGTCCA pLX_317 17.9% 89.4% 94.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV