Transcript: Mouse NM_009758.4

Mus musculus bone morphogenetic protein receptor, type 1A (Bmpr1a), mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Mus musculus (mouse)
Gene:
Bmpr1a (12166)
Length:
5481
CDS:
407..2005

Additional Resources:

NCBI RefSeq record:
NM_009758.4
NBCI Gene record:
Bmpr1a (12166)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009758.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274553 GGGTCGTTACAACCGTGATTT pLKO_005 964 CDS 100% 13.200 18.480 N Bmpr1a n/a
2 TRCN0000022622 CCCTGTTGTTATAGGTCCGTT pLKO.1 823 CDS 100% 2.640 3.696 N Bmpr1a n/a
3 TRCN0000274552 CAATTTGTGCAACCAGTATTT pLKO_005 787 CDS 100% 13.200 9.240 N Bmpr1a n/a
4 TRCN0000022619 GCTGGATGAAAGCCTGAATAA pLKO.1 1642 CDS 100% 13.200 9.240 N Bmpr1a n/a
5 TRCN0000274499 GCTGGATGAAAGCCTGAATAA pLKO_005 1642 CDS 100% 13.200 9.240 N Bmpr1a n/a
6 TRCN0000274550 TCAAGACTCCAATCCTGATAA pLKO_005 2300 3UTR 100% 13.200 9.240 N Bmpr1a n/a
7 TRCN0000022621 GCCCTACTCAAGTTAGCTTAT pLKO.1 1394 CDS 100% 10.800 7.560 N Bmpr1a n/a
8 TRCN0000000795 CGTGATTTGGAACAGGATGAA pLKO.1 977 CDS 100% 4.950 3.465 N BMPR1A n/a
9 TRCN0000286056 CGTGATTTGGAACAGGATGAA pLKO_005 977 CDS 100% 4.950 3.465 N BMPR1A n/a
10 TRCN0000022620 GCCATTATAGAAGAAGATGAT pLKO.1 656 CDS 100% 4.950 3.465 N Bmpr1a n/a
11 TRCN0000000796 TCTCTCTATGACTTCCTGAAA pLKO.1 1352 CDS 100% 4.950 3.465 N BMPR1A n/a
12 TRCN0000022623 CCACATTAACTTCTGGGTGTA pLKO.1 687 CDS 100% 4.050 2.835 N Bmpr1a n/a
13 TRCN0000274551 CCACATTAACTTCTGGGTGTA pLKO_005 687 CDS 100% 4.050 2.835 N Bmpr1a n/a
14 TRCN0000196733 GCTGTTAAATTCAACAGTGAC pLKO.1 1556 CDS 100% 0.405 0.243 N BMPR1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009758.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14549 pDONR223 0% 90.9% 97.9% None (many diffs) n/a
2 ccsbBroad304_14549 pLX_304 0% 90.9% 97.9% V5 (many diffs) n/a
3 TRCN0000465377 ACACAAAGACGATGAGACGCTTTT pLX_317 16.8% 90.8% 97.7% V5 (many diffs) n/a
4 TRCN0000489757 CTCCGATCCCGCGCCATTGGAACA pLX_317 23.3% 90.9% 97.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_10423 pDONR223 100% 90.7% 97.5% None (many diffs) n/a
6 ccsbBroad304_10423 pLX_304 0% 90.7% 97.5% V5 (not translated due to frame shift) (many diffs) n/a
7 TRCN0000467651 GCTTTACATTAAATTTCAAATCGT pLX_317 25.5% 90.7% 97.5% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV