Transcript: Mouse NM_010077.2

Mus musculus dopamine receptor D2 (Drd2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Drd2 (13489)
Length:
1549
CDS:
95..1429

Additional Resources:

NCBI RefSeq record:
NM_010077.2
NBCI Gene record:
Drd2 (13489)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010077.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350594 CCGTTATCATGAAGTCTAATG pLKO_005 855 CDS 100% 10.800 15.120 N DRD2 n/a
2 TRCN0000220817 CCCAGGATTGCCAAGTTCTTT pLKO.1 1100 CDS 100% 5.625 4.500 N Drd2 n/a
3 TRCN0000220821 CATTGTTCTTGGTGTGTTCAT pLKO.1 1225 CDS 100% 4.950 3.465 N Drd2 n/a
4 TRCN0000221104 GCACCGTTATCATGAAGTCTA pLKO.1 852 CDS 100% 4.950 3.465 N DRD2 n/a
5 TRCN0000220818 CCACTACAACTACTATGCCAT pLKO.1 190 CDS 100% 2.640 1.848 N Drd2 n/a
6 TRCN0000220819 GACCAGAATGAGTGTATCATT pLKO.1 626 CDS 100% 0.563 0.394 N Drd2 n/a
7 TRCN0000220820 CAGGATTCACTGTGACATCTT pLKO.1 403 CDS 100% 4.950 2.970 N Drd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010077.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00463 pDONR223 100% 90.6% 95.4% None (many diffs) n/a
2 ccsbBroad304_00463 pLX_304 0% 90.6% 95.4% V5 (many diffs) n/a
3 TRCN0000488273 GATCGTCTGGAGCATGTGCGTGAT pLX_317 20.9% 90.6% 95.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000491720 TAGACATTTATATTTTAGCAAATA pLX_317 30.7% 90.5% 95.2% V5 (many diffs) n/a
5 TRCN0000491632 TTTTAAGCCAAGGCCATCCTTAGT pLX_317 31.4% 84.3% 89.1% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000492361 TGAAGAGACCCTCGCTAGATCGCA pLX_317 37.6% 84.2% 88.9% V5 (many diffs) n/a
Download CSV