Transcript: Mouse NM_010153.1

Mus musculus erb-b2 receptor tyrosine kinase 3 (Erbb3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Erbb3 (13867)
Length:
4020
CDS:
1..4020

Additional Resources:

NCBI RefSeq record:
NM_010153.1
NBCI Gene record:
Erbb3 (13867)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023432 GTTGGATGATTGACGAGAATA pLKO.1 2834 CDS 100% 13.200 18.480 N Erbb3 n/a
2 TRCN0000374294 CCCTTGAGAGTATCCACTTTG pLKO_005 2630 CDS 100% 10.800 15.120 N Erbb3 n/a
3 TRCN0000379016 TTGTGCTCGATGCGCCCATTT pLKO_005 1716 CDS 100% 10.800 8.640 N Erbb3 n/a
4 TRCN0000365981 GAGGCCAAGACTCCAATTAAA pLKO_005 2602 CDS 100% 15.000 10.500 N Erbb3 n/a
5 TRCN0000366055 CTTTGCCACATGGATACAATT pLKO_005 463 CDS 100% 13.200 9.240 N Erbb3 n/a
6 TRCN0000366056 GACCGTGGACTCTAGCAATAT pLKO_005 1023 CDS 100% 13.200 9.240 N Erbb3 n/a
7 TRCN0000374295 GAGATTACAGGCTACCTAAAC pLKO_005 1174 CDS 100% 10.800 7.560 N Erbb3 n/a
8 TRCN0000023433 GCTCTCTCCTTGATCATGTAA pLKO.1 2372 CDS 100% 5.625 3.938 N Erbb3 n/a
9 TRCN0000023431 GCAGAGGTATTAATGAGCAAA pLKO.1 1897 CDS 100% 4.950 3.465 N Erbb3 n/a
10 TRCN0000023430 CCAGATATTGACCAAGACCAT pLKO.1 606 CDS 100% 2.640 1.848 N Erbb3 n/a
11 TRCN0000023429 CGTGTCTACATAAGTGCCAAT pLKO.1 1357 CDS 100% 4.050 2.430 N Erbb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14632 pDONR223 0% 86.7% 90.6% None (many diffs) n/a
2 TRCN0000480432 CTGACGCAGTTTGTCTGTGAGAGG pLX_317 8.6% 86.7% 90.6% V5 (many diffs) n/a
3 ccsbBroad304_14632 pLX_304 11.8% 86.6% 90.6% V5 (many diffs) n/a
4 TRCN0000489936 ATCGTACGAATTATGCCTGTGTGC pLX_317 10.8% 86.6% 90.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000491817 GCTTTGGTTCCCATGATTGGGTGG pLX_317 8.5% 86.6% 90.6% V5 (many diffs) n/a
6 ccsbBroadEn_10806 pDONR223 100% 21.6% 22.7% None (many diffs) n/a
7 ccsbBroad304_10806 pLX_304 0% 21.6% 22.7% V5 (many diffs) n/a
8 TRCN0000481555 AGGCGAGCCAACTGCTTGACAGGT pLX_317 53.7% 21.6% 22.7% V5 (many diffs) n/a
Download CSV