Transcript: Mouse NM_010305.1

Mus musculus guanine nucleotide binding protein (G protein), alpha inhibiting 1 (Gnai1), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Gnai1 (14677)
Length:
3193
CDS:
245..1309

Additional Resources:

NCBI RefSeq record:
NM_010305.1
NBCI Gene record:
Gnai1 (14677)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010305.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341951 CTGTAACAGACGTCATCATAA pLKO_005 1257 CDS 100% 13.200 18.480 N Gnai1 n/a
2 TRCN0000352583 ACGATTCGGCAGCGTACTATC pLKO_005 690 CDS 100% 10.800 15.120 N Gnai1 n/a
3 TRCN0000341949 TACCTTCAAAGATCTTCATTT pLKO_005 811 CDS 100% 0.000 0.000 N Gnai1 n/a
4 TRCN0000341948 CAGTTTGAAGACCTCAATAAA pLKO_005 1160 CDS 100% 15.000 12.000 N Gnai1 n/a
5 TRCN0000341950 CCAACAGATGAGTACTTATAT pLKO_005 1340 3UTR 100% 15.000 12.000 N Gnai1 n/a
6 TRCN0000124862 GAATCTGGAAAGAGTACCATT pLKO.1 371 CDS 100% 4.950 2.970 N Gnai1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010305.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06291 pDONR223 100% 88.2% 99.4% None (many diffs) n/a
2 ccsbBroad304_06291 pLX_304 0% 88.2% 99.4% V5 (many diffs) n/a
3 TRCN0000471008 GATTTGGTAGTCACACGCTTACGT pLX_317 38% 88.2% 99.4% V5 (many diffs) n/a
Download CSV