Transcript: Mouse NM_011018.3

Mus musculus sequestosome 1 (Sqstm1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Sqstm1 (18412)
Length:
2030
CDS:
64..1392

Additional Resources:

NCBI RefSeq record:
NM_011018.3
NBCI Gene record:
Sqstm1 (18412)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011018.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098616 CCGCATCTACATTAAAGAGAA pLKO.1 348 CDS 100% 4.950 6.930 N Sqstm1 n/a
2 TRCN0000098618 GCTATGTCCTATGTGAAAGAT pLKO.1 319 CDS 100% 5.625 4.500 N Sqstm1 n/a
3 TRCN0000238133 TAGTACAACTGCTAGTTATTT pLKO_005 1750 3UTR 100% 15.000 10.500 N Sqstm1 n/a
4 TRCN0000238132 AGACGATGACTGGACACATTT pLKO_005 1071 CDS 100% 13.200 9.240 N Sqstm1 n/a
5 TRCN0000098617 GCTCCTACAGACCAAGAATTA pLKO.1 1314 CDS 100% 13.200 9.240 N Sqstm1 n/a
6 TRCN0000238135 TGTGGTGGGAACTCGCTATAA pLKO_005 465 CDS 100% 13.200 9.240 N Sqstm1 n/a
7 TRCN0000238134 CACCCTCCACCATTGTGATAG pLKO_005 1375 CDS 100% 10.800 7.560 N Sqstm1 n/a
8 TRCN0000257058 GTCTCTACAGATGCCAGAATC pLKO_005 1131 CDS 100% 10.800 7.560 N Sqstm1 n/a
9 TRCN0000098615 CCCTTTGTCTTGTAGTTGCAT pLKO.1 1416 3UTR 100% 3.000 2.100 N Sqstm1 n/a
10 TRCN0000098619 GAGGTTGACATTGATGTGGAA pLKO.1 823 CDS 100% 2.640 1.848 N Sqstm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011018.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07320 pDONR223 100% 86.4% 90.4% None (many diffs) n/a
2 ccsbBroad304_07320 pLX_304 0% 86.4% 90.4% V5 (many diffs) n/a
3 TRCN0000473054 TTTGGGCAGAGCAACTTGACTTTT pLX_317 40.9% 86.4% 90.4% V5 (many diffs) n/a
4 ccsbBroadEn_07321 pDONR223 100% 69.5% 73.3% None (many diffs) n/a
5 ccsbBroad304_07321 pLX_304 0% 69.5% 73.3% V5 (many diffs) n/a
6 TRCN0000474612 TGACTTAAAACTTTCTAAGGACCA pLX_317 48.6% 69.5% 73.3% V5 (many diffs) n/a
Download CSV