Transcript: Mouse NM_011031.2

Mus musculus procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha II polypeptide (P4ha2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
P4ha2 (18452)
Length:
2284
CDS:
264..1877

Additional Resources:

NCBI RefSeq record:
NM_011031.2
NBCI Gene record:
P4ha2 (18452)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011031.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076472 CGGTACTTTGAACGGTTGTTA pLKO.1 1011 CDS 100% 5.625 7.875 N P4ha2 n/a
2 TRCN0000076469 CGATCTGATTTACGCAGAGAA pLKO.1 362 CDS 100% 4.950 6.930 N P4ha2 n/a
3 TRCN0000326622 CGATCTGATTTACGCAGAGAA pLKO_005 362 CDS 100% 4.950 6.930 N P4ha2 n/a
4 TRCN0000076470 GCGGTACTTTGAACGGTTGTT pLKO.1 1010 CDS 100% 4.950 6.930 N P4ha2 n/a
5 TRCN0000326557 GCGGTACTTTGAACGGTTGTT pLKO_005 1010 CDS 100% 4.950 6.930 N P4ha2 n/a
6 TRCN0000076471 CGTCAGGTACTATGATGTGAT pLKO.1 1283 CDS 100% 4.950 3.960 N P4ha2 n/a
7 TRCN0000326559 CGTCAGGTACTATGATGTGAT pLKO_005 1283 CDS 100% 4.950 3.960 N P4ha2 n/a
8 TRCN0000076468 CCAAATCATCTTCAAGTTCAA pLKO.1 1913 3UTR 100% 4.950 3.465 N P4ha2 n/a
9 TRCN0000326561 CCAAATCATCTTCAAGTTCAA pLKO_005 1913 3UTR 100% 4.950 3.465 N P4ha2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011031.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02057 pDONR223 100% 85.5% 90.1% None (many diffs) n/a
2 ccsbBroad304_02057 pLX_304 0% 85.5% 90.1% V5 (many diffs) n/a
3 TRCN0000473272 CCGAGGCGTGAGTGCACACGACAT pLX_317 33% 85.5% 90.1% V5 (many diffs) n/a
4 ccsbBroadEn_11323 pDONR223 100% 80.8% 86.2% None (many diffs) n/a
5 ccsbBroad304_11323 pLX_304 0% 80.8% 86.2% V5 (many diffs) n/a
6 TRCN0000476518 ACGCTTCCGCGATGTGGGGCCGGA pLX_317 29.5% 80.8% 86.2% V5 (many diffs) n/a
Download CSV