Transcript: Mouse NM_011784.3

Mus musculus apelin receptor (Aplnr), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Aplnr (23796)
Length:
3573
CDS:
274..1407

Additional Resources:

NCBI RefSeq record:
NM_011784.3
NBCI Gene record:
Aplnr (23796)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011784.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426595 ATAAATGAGGGAAGGTTATAT pLKO_005 1675 3UTR 100% 15.000 12.000 N Aplnr n/a
2 TRCN0000429437 TGAGAAGTCAGCCAGTTATTC pLKO_005 1287 CDS 100% 13.200 9.240 N Aplnr n/a
3 TRCN0000221262 CCTGATCTAATTTGCTTCATT pLKO.1 1722 3UTR 100% 5.625 3.938 N Aplnr n/a
4 TRCN0000221265 CGATTCCCTATAGTCAAGAAA pLKO.1 1373 CDS 100% 5.625 3.938 N Aplnr n/a
5 TRCN0000221263 CCTGGTGAAGACTCTCTACAT pLKO.1 1062 CDS 100% 4.950 3.465 N Aplnr n/a
6 TRCN0000221264 CCTGCCATCTACATGTTGGTT pLKO.1 361 CDS 100% 3.000 2.100 N Aplnr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011784.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00040 pDONR223 100% 86.9% 91.5% None (many diffs) n/a
2 ccsbBroad304_00040 pLX_304 0% 86.9% 91.5% V5 (many diffs) n/a
3 TRCN0000467691 CGATTAGGCTTAGGGCTGCGAGTT pLX_317 9.5% 86.9% 91.5% V5 (many diffs) n/a
4 TRCN0000491419 TATCAGGTTCTGCCAGGCCGGAGC pLX_317 25.4% 86.9% 91.5% V5 (many diffs) n/a
5 TRCN0000487737 ATTGGGATACTGGTGTTTCGATTA pLX_317 23.7% 86.9% 91.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV