Transcript: Mouse NM_011894.3

Mus musculus SH3-domain binding protein 5 (BTK-associated) (Sh3bp5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Sh3bp5 (24056)
Length:
3908
CDS:
144..1520

Additional Resources:

NCBI RefSeq record:
NM_011894.3
NBCI Gene record:
Sh3bp5 (24056)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011894.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190447 GCAACGGTGAAACTAGACGAA pLKO.1 390 CDS 100% 2.640 3.696 N Sh3bp5 n/a
2 TRCN0000240725 ACCGACGAGTCCGTCTGAAAT pLKO_005 1133 CDS 100% 13.200 10.560 N Sh3bp5 n/a
3 TRCN0000122325 CATCAACAAGTCCAAGCCTTA pLKO.1 764 CDS 100% 4.050 3.240 N SH3BP5 n/a
4 TRCN0000240722 GCCTATGTGCAGATCATATTT pLKO_005 1538 3UTR 100% 15.000 10.500 N Sh3bp5 n/a
5 TRCN0000240726 ATGGAATTATTGCTGACATAA pLKO_005 1480 CDS 100% 13.200 9.240 N Sh3bp5 n/a
6 TRCN0000217689 GTTTATGCTGCACCTAGTATT pLKO.1 2349 3UTR 100% 13.200 9.240 N Sh3bp5 n/a
7 TRCN0000240723 AGGATGACAAGCGGCAGTTTG pLKO_005 586 CDS 100% 10.800 7.560 N Sh3bp5 n/a
8 TRCN0000240724 CCCAGTCTGTGTCCAGCTTTA pLKO_005 1105 CDS 100% 10.800 7.560 N Sh3bp5 n/a
9 TRCN0000139445 CAGGGAGAACTGGAGAAGTTA pLKO.1 288 CDS 100% 5.625 3.938 N SH3BP5 n/a
10 TRCN0000319397 CAGGGAGAACTGGAGAAGTTA pLKO_005 288 CDS 100% 5.625 3.938 N SH3BP5 n/a
11 TRCN0000192876 GAGTGACAAAGCCAACAACAA pLKO.1 1334 CDS 100% 4.950 3.465 N Sh3bp5 n/a
12 TRCN0000190910 CCATCAACAAGTCCAAGCCTT pLKO.1 763 CDS 100% 2.640 1.848 N Sh3bp5 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1955 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011894.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14020 pDONR223 100% 82.6% 87.1% None (many diffs) n/a
2 ccsbBroad304_14020 pLX_304 0% 82.6% 87.1% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000465450 CCGAAAGCAACTTGTTGGTTTCAC pLX_317 32.5% 82.6% 87.1% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_14941 pDONR223 0% 82.6% 87.1% None (many diffs) n/a
5 ccsbBroad304_14941 pLX_304 0% 82.6% 87.1% V5 (many diffs) n/a
6 TRCN0000473064 CATTCACGTCCACACCCTGCCGCC pLX_317 27.7% 82.6% 87.1% V5 (many diffs) n/a
Download CSV