Transcript: Human NM_012184.4

Homo sapiens forkhead box D4 like 1 (FOXD4L1), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
FOXD4L1 (200350)
Length:
2067
CDS:
174..1400

Additional Resources:

NCBI RefSeq record:
NM_012184.4
NBCI Gene record:
FOXD4L1 (200350)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012184.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435307 AGTGTTATTCCTAAGTCTAGT pLKO_005 1873 3UTR 100% 4.950 2.970 N FOXD4L1 n/a
2 TRCN0000107795 CGTGCCATCTTTAATGTTAAA pLKO.1 1990 3UTR 100% 13.200 6.600 Y FOXD4L3 n/a
3 TRCN0000016767 GTCAAGCCTGTCGGACAATTT pLKO.1 1247 CDS 100% 13.200 6.600 Y FOXD4L1 n/a
4 TRCN0000422982 AGAAAGAAACAGCTGGATTAC pLKO_005 1627 3UTR 100% 10.800 5.400 Y FOXD4L1 n/a
5 TRCN0000255488 CCCAGGACATGTTCGACAATG pLKO_005 733 CDS 100% 10.800 5.400 Y FOXD4L4 n/a
6 TRCN0000107900 GCCTAGTTATATAGACGAAAT pLKO.1 2030 3UTR 100% 10.800 5.400 Y FOXD4L3 n/a
7 TRCN0000262816 GATGCATCTCTTTCAGCATTG pLKO_005 1132 CDS 100% 6.000 3.000 Y FOXD4L6 n/a
8 TRCN0000255490 ACTCGTACATCGCGCTCATCA pLKO_005 502 CDS 100% 4.950 2.475 Y FOXD4L4 n/a
9 TRCN0000420020 CAGAGTTTGGCACCGAGTTCA pLKO_005 421 CDS 100% 4.950 2.475 Y FOXD4L1 n/a
10 TRCN0000017866 CTCTTTCAGCATTGAGAGTAT pLKO.1 1139 CDS 100% 4.950 2.475 Y FOXD4 n/a
11 TRCN0000174049 CTCTTTCAGCATTGAGAGTAT pLKO.1 1139 CDS 100% 4.950 2.475 Y FOXD4 n/a
12 TRCN0000017864 GAACGACTGCTTCGTCAAGAT pLKO.1 656 CDS 100% 4.950 2.475 Y FOXD4 n/a
13 TRCN0000413344 TGAACGACTGCTTCGTCAAGA pLKO_005 655 CDS 100% 4.950 2.475 Y FOXD4L1 n/a
14 TRCN0000107902 CTACTCGTACATCGCGCTCAT pLKO.1 500 CDS 100% 4.050 2.025 Y FOXD4L3 n/a
15 TRCN0000262395 TACTCGTACATCGCGCTCATC pLKO_005 501 CDS 100% 4.050 2.025 Y FOXD4L5 n/a
16 TRCN0000262819 TTTCAAGCGCCACCAACTGAC pLKO_005 779 CDS 100% 4.050 2.025 Y FOXD4L6 n/a
17 TRCN0000107904 CATGTTCGACAATGGCAGCTT pLKO.1 740 CDS 100% 2.640 1.320 Y FOXD4L3 n/a
18 TRCN0000016763 CGGATGCATCTCTTTCAGCAT pLKO.1 1130 CDS 100% 2.640 1.320 Y FOXD4L1 n/a
19 TRCN0000016765 GAAGATGAAGACGAGGTGGAA pLKO.1 273 CDS 100% 2.640 1.320 Y FOXD4L1 n/a
20 TRCN0000016766 CCGGCGTAGGAAGCGTTTCAA pLKO.1 764 CDS 100% 1.875 0.938 Y FOXD4L1 n/a
21 TRCN0000017867 GCAGAACAGCATCCGCCACAA pLKO.1 626 CDS 100% 1.350 0.675 Y FOXD4 n/a
22 TRCN0000016764 CGCCTTCATTAGTGGCCGCTT pLKO.1 575 CDS 100% 0.720 0.360 Y FOXD4L1 n/a
23 TRCN0000021031 CTTTCAGCATTGAGAGTATTA pLKO.1 1141 CDS 100% 13.200 6.600 Y FOXD4L4 n/a
24 TRCN0000107796 TCTTTCAGCATTGAGAGTATT pLKO.1 1140 CDS 100% 13.200 6.600 Y FOXD4L3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012184.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10191 pDONR223 100% 91.9% 67.9% None (many diffs) n/a
2 ccsbBroad304_10191 pLX_304 0% 91.9% 67.9% V5 (many diffs) n/a
3 TRCN0000469817 ACCTCCTTCAGGTTCAAAACTAGC pLX_317 27.3% 91.9% 67.9% V5 (many diffs) n/a
4 ccsbBroadEn_00574 pDONR223 100% 90% 65.8% None (many diffs) n/a
5 ccsbBroad304_00574 pLX_304 0% 90% 65.8% V5 (many diffs) n/a
6 TRCN0000476871 CCCACCCTAACGAGCTCGAATCCA pLX_317 25.3% 90% 65.8% V5 (many diffs) n/a
Download CSV