Transcript: Human NM_012455.3

Homo sapiens pleckstrin and Sec7 domain containing 4 (PSD4), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PSD4 (23550)
Length:
11342
CDS:
196..3366

Additional Resources:

NCBI RefSeq record:
NM_012455.3
NBCI Gene record:
PSD4 (23550)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012455.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436388 TTCCCTGTGCCCATCTATAAA pLKO_005 1153 CDS 100% 15.000 10.500 N PSD4 n/a
2 TRCN0000429097 GAATCCAGAGTGGCCTCATTT pLKO_005 3678 3UTR 100% 13.200 9.240 N PSD4 n/a
3 TRCN0000427083 TCCCTGGAGGAGACTTATTTC pLKO_005 3424 3UTR 100% 13.200 9.240 N PSD4 n/a
4 TRCN0000424411 TGCAGAAGAACAATGACTTTA pLKO_005 2024 CDS 100% 13.200 9.240 N PSD4 n/a
5 TRCN0000416818 GCTGGAGACAAGCTAGCTAAT pLKO_005 1915 CDS 100% 10.800 7.560 N PSD4 n/a
6 TRCN0000179046 CACCTTGACATGTGCAATCAT pLKO.1 2238 CDS 100% 5.625 3.938 N PSD4 n/a
7 TRCN0000178848 CAGCCAAGTTCCTTGAAGAAA pLKO.1 1690 CDS 100% 5.625 3.938 N PSD4 n/a
8 TRCN0000181027 CCTCCTGAATCTACCAGACAA pLKO.1 481 CDS 100% 4.950 3.465 N PSD4 n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 7103 3UTR 100% 4.950 2.475 Y n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7319 3UTR 100% 13.200 6.600 Y LIAS n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5768 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5768 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012455.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11749 pDONR223 100% 97.1% 97% None (many diffs) n/a
2 ccsbBroad304_11749 pLX_304 0% 97.1% 97% V5 (many diffs) n/a
3 TRCN0000478404 ATCGGCATAACCCGATTTCTCATA pLX_317 7.9% 97.1% 97% V5 (many diffs) n/a
Download CSV