Transcript: Mouse NM_013696.2

Mus musculus thyrotropin releasing hormone receptor (Trhr), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Trhr (22045)
Length:
3976
CDS:
350..1531

Additional Resources:

NCBI RefSeq record:
NM_013696.2
NBCI Gene record:
Trhr (22045)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013696.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027853 CCTAAATTACAGTGTCATCAA pLKO.1 1402 CDS 100% 4.950 6.930 N Trhr n/a
2 TRCN0000027770 GCCCAGTTTCTCTGCACGTTT pLKO.1 746 CDS 100% 4.950 6.930 N Trhr n/a
3 TRCN0000027839 GCAGTGGTTGTAATTCTGTTT pLKO.1 1154 CDS 100% 4.950 3.960 N Trhr n/a
4 TRCN0000027813 CCATCTTACTTGTGGTCATTA pLKO.1 432 CDS 100% 13.200 9.240 N Trhr n/a
5 TRCN0000014191 CCTATTTACCTAATGGACTTT pLKO.1 917 CDS 100% 4.950 3.465 N TRHR n/a
6 TRCN0000027830 CCCAGTGATTTACAACCTCAT pLKO.1 1297 CDS 100% 4.050 2.835 N Trhr n/a
7 TRCN0000163318 GAGAAAGGAAAGGAAGGGAAA pLKO.1 3284 3UTR 100% 4.050 2.430 N LSMEM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013696.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01711 pDONR223 100% 89.2% 93.2% None (many diffs) n/a
2 ccsbBroad304_01711 pLX_304 0% 89.2% 93.2% V5 (many diffs) n/a
3 TRCN0000475816 CGCACAGCGTTGAAACACGAAACA pLX_317 28.5% 89.2% 93.2% V5 (many diffs) n/a
4 TRCN0000489783 CCTAGTAAAGACAGGGTTTATGTG pLX_317 32% 89.2% 93.2% V5 (many diffs) n/a
5 TRCN0000488346 AGCCCAGACCAAATCGGACTCCGC pLX_317 26.4% 89.2% 93.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV