Transcript: Human NM_014508.3

Homo sapiens apolipoprotein B mRNA editing enzyme catalytic subunit 3C (APOBEC3C), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
APOBEC3C (27350)
Length:
2644
CDS:
107..679

Additional Resources:

NCBI RefSeq record:
NM_014508.3
NBCI Gene record:
APOBEC3C (27350)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014508.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052101 GCACATTCTACTTCCAATTTA pLKO.1 150 CDS 100% 15.000 10.500 N APOBEC3C n/a
2 TRCN0000299627 GCACATTCTACTTCCAATTTA pLKO_005 150 CDS 100% 15.000 10.500 N APOBEC3C n/a
3 TRCN0000052099 CGCCTCTACTACTTCCAGTAT pLKO.1 470 CDS 100% 4.950 3.465 N APOBEC3C n/a
4 TRCN0000299626 CGCCTCTACTACTTCCAGTAT pLKO_005 470 CDS 100% 4.950 3.465 N APOBEC3C n/a
5 TRCN0000052102 CGCTGTGGAGATCATGGACTA pLKO.1 535 CDS 100% 4.050 2.835 N APOBEC3C n/a
6 TRCN0000299560 CGCTGTGGAGATCATGGACTA pLKO_005 535 CDS 100% 4.050 2.835 N APOBEC3C n/a
7 TRCN0000052098 CCAGGCACATTCTACTTCCAA pLKO.1 146 CDS 100% 3.000 2.100 N APOBEC3C n/a
8 TRCN0000052100 ACCAACTTTCGACTTCTGAAA pLKO.1 632 CDS 100% 4.950 2.475 Y APOBEC3C n/a
9 TRCN0000299628 ACCAACTTTCGACTTCTGAAA pLKO_005 632 CDS 100% 4.950 2.475 Y APOBEC3C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014508.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08087 pDONR223 100% 99.8% 99.4% None 91A>G n/a
2 ccsbBroad304_08087 pLX_304 0% 99.8% 99.4% V5 91A>G n/a
3 TRCN0000480993 GATCGGGACTTACTATGTTTATTC pLX_317 71.3% 99.8% 99.4% V5 91A>G n/a
4 ccsbBroadEn_09805 pDONR223 100% 45.8% 39.1% None (many diffs) n/a
5 ccsbBroad304_09805 pLX_304 0% 45.8% 39.1% V5 (many diffs) n/a
6 TRCN0000468435 GTGTACATTTACATTTGTTTCTTA pLX_317 35% 45.8% 39.1% V5 (many diffs) n/a
7 ccsbBroadEn_09588 pDONR223 100% 44.4% 37.5% None (many diffs) n/a
8 ccsbBroad304_09588 pLX_304 0% 44.4% 37.5% V5 (many diffs) n/a
9 TRCN0000466607 ACTCGATAAAACTAGGGCTATTAC pLX_317 33.8% 44.4% 37.5% V5 (many diffs) n/a
Download CSV