Transcript: Human NM_015264.1

Homo sapiens KIAA0930 (KIAA0930), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-06-23
Taxon:
Homo sapiens (human)
Gene:
KIAA0930 (23313)
Length:
6287
CDS:
124..1353

Additional Resources:

NCBI RefSeq record:
NM_015264.1
NBCI Gene record:
KIAA0930 (23313)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015264.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161338 GATGTCGTTTGGCTTCTACAA pLKO.1 825 CDS 100% 4.950 6.930 N KIAA0930 n/a
2 TRCN0000133660 GCACGATTTCATGTTCCTAAA pLKO.1 2958 3UTR 100% 10.800 7.560 N KIAA0930 n/a
3 TRCN0000134892 CCCAACATCTTCTTCATGATT pLKO.1 619 CDS 100% 5.625 3.938 N KIAA0930 n/a
4 TRCN0000159289 GCACATTTGTACTTCTTGTAA pLKO.1 3956 3UTR 100% 5.625 3.938 N KIAA0930 n/a
5 TRCN0000137129 CGTCTTCTGGACTTGGATGTT pLKO.1 225 CDS 100% 4.950 3.465 N KIAA0930 n/a
6 TRCN0000161558 GATGTTCTCCACCTACTTCAT pLKO.1 240 CDS 100% 4.950 3.465 N KIAA0930 n/a
7 TRCN0000163605 CCTGAATCTCATCCTGCAGAA pLKO.1 453 CDS 100% 4.050 2.835 N KIAA0930 n/a
8 TRCN0000164207 CGATCTGCACAATGCAACCAA pLKO.1 1155 CDS 100% 3.000 2.100 N KIAA0930 n/a
9 TRCN0000160345 CTTCTTCATGATTGACAGCTT pLKO.1 627 CDS 100% 2.640 1.848 N KIAA0930 n/a
10 TRCN0000164209 CAACATGGAGTTTGTGCGCAT pLKO.1 852 CDS 100% 2.160 1.512 N KIAA0930 n/a
11 TRCN0000163173 GAGTGTCTACAGGTGACACAT pLKO.1 917 CDS 100% 0.495 0.347 N KIAA0930 n/a
12 TRCN0000164208 CTGAAGCTGAACAGAGCAGAT pLKO.1 1228 CDS 100% 4.050 2.430 N KIAA0930 n/a
13 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4174 3UTR 100% 4.950 2.475 Y ERAP2 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4175 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015264.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11718 pDONR223 100% 90.4% 90.4% None 1_117del n/a
2 ccsbBroad304_11718 pLX_304 0% 90.4% 90.4% V5 1_117del n/a
3 TRCN0000469558 CATGGACCTATTCTGCATCAAGCG pLX_317 39.9% 90.4% 90.4% V5 1_117del n/a
Download CSV