Transcript: Mouse NM_015747.2

Mus musculus solute carrier family 20, member 1 (Slc20a1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Slc20a1 (20515)
Length:
3316
CDS:
491..2536

Additional Resources:

NCBI RefSeq record:
NM_015747.2
NBCI Gene record:
Slc20a1 (20515)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313521 TCCGCTGCTTTCTGGTATTAT pLKO_005 997 CDS 100% 15.000 21.000 N Slc20a1 n/a
2 TRCN0000313451 AGACGCTGACATGGCCTAATG pLKO_005 1836 CDS 100% 10.800 15.120 N Slc20a1 n/a
3 TRCN0000068406 CGCTATCATGGCAGTATTCAA pLKO.1 2494 CDS 100% 5.625 7.875 N Slc20a1 n/a
4 TRCN0000317074 CGCTATCATGGCAGTATTCAA pLKO_005 2494 CDS 100% 5.625 7.875 N Slc20a1 n/a
5 TRCN0000043053 GCCCTTATCGTCTGGTTCTTT pLKO.1 1229 CDS 100% 5.625 7.875 N SLC20A1 n/a
6 TRCN0000306853 GCCCTTATCGTCTGGTTCTTT pLKO_005 1229 CDS 100% 5.625 7.875 N SLC20A1 n/a
7 TRCN0000068407 CTCCGATCAAAGAAGGCTGTT pLKO.1 2402 CDS 100% 4.050 5.670 N Slc20a1 n/a
8 TRCN0000068404 CCCATTGTATTGTCGGTGCAA pLKO.1 891 CDS 100% 2.640 3.696 N Slc20a1 n/a
9 TRCN0000317138 CCCATTGTATTGTCGGTGCAA pLKO_005 891 CDS 100% 2.640 3.696 N Slc20a1 n/a
10 TRCN0000313522 CCAACATGCACAGGGATTTAA pLKO_005 2925 3UTR 100% 15.000 10.500 N Slc20a1 n/a
11 TRCN0000068403 CCACCGAAGTATGACAATCTA pLKO.1 548 CDS 100% 5.625 3.938 N Slc20a1 n/a
12 TRCN0000068405 GCGGATTCGAATGGACAGTTA pLKO.1 1870 CDS 100% 4.950 3.465 N Slc20a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01551 pDONR223 100% 88.1% 90.3% None (many diffs) n/a
2 ccsbBroad304_01551 pLX_304 0% 88.1% 90.3% V5 (many diffs) n/a
3 TRCN0000479800 ACTTAGTCTTTACCCATGGCTTCA pLX_317 9.1% 88.1% 90.3% V5 (many diffs) n/a
Download CSV