Transcript: Human NM_016540.4

Homo sapiens G protein-coupled receptor 83 (GPR83), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
GPR83 (10888)
Length:
4277
CDS:
173..1444

Additional Resources:

NCBI RefSeq record:
NM_016540.4
NBCI Gene record:
GPR83 (10888)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016540.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357320 ATCCCTAAGGGAGACCTAAAT pLKO_005 1801 3UTR 100% 13.200 18.480 N GPR83 n/a
2 TRCN0000357317 ATGAGCAGCACCTGCTATAAC pLKO_005 1175 CDS 100% 13.200 18.480 N GPR83 n/a
3 TRCN0000008904 CTTCATATACTGCTGGCTGAA pLKO.1 1198 CDS 100% 4.050 3.240 N GPR83 n/a
4 TRCN0000357318 ACCTGGCAGTTGCCGACATAA pLKO_005 507 CDS 100% 13.200 9.240 N GPR83 n/a
5 TRCN0000357263 TGAACAGCACATGGATATTTG pLKO_005 570 CDS 100% 13.200 9.240 N GPR83 n/a
6 TRCN0000008905 CCAAGAAACTGTGGCTGTGTA pLKO.1 960 CDS 100% 4.950 3.465 N GPR83 n/a
7 TRCN0000008903 CCACATGCTATCTGCCAGAAA pLKO.1 779 CDS 100% 4.950 3.465 N GPR83 n/a
8 TRCN0000008906 CTTCTTCTCTTGGAACAACTA pLKO.1 292 CDS 100% 4.950 3.465 N GPR83 n/a
9 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 2458 3UTR 100% 1.080 0.540 Y GPR83 n/a
10 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 2458 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016540.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07699 pDONR223 100% 99.9% 100% None 1182T>C n/a
2 ccsbBroad304_07699 pLX_304 0% 99.9% 100% V5 1182T>C n/a
3 TRCN0000492129 AGCTAGTGAAGCCGACCCCTACCG pLX_317 30.4% 99.9% 100% V5 1182T>C n/a
4 TRCN0000488363 GCATAAAACGCTGCCTGCCTCTGC pLX_317 18.6% 99.8% 99.5% V5 1121C>A;1269_1270insG n/a
Download CSV