Transcript: Mouse NM_016747.4

Mus musculus discs, large homolog 3 (Drosophila) (Dlg3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Dlg3 (53310)
Length:
5001
CDS:
351..2900

Additional Resources:

NCBI RefSeq record:
NM_016747.4
NBCI Gene record:
Dlg3 (53310)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016747.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024846 CCTACTCGTTACTCTCCTATT pLKO.1 1494 CDS 100% 10.800 15.120 N Dlg3 n/a
2 TRCN0000144685 GACTCACTGGAAGAGATTTAT pLKO.1 2808 CDS 100% 15.000 10.500 N DLG3 n/a
3 TRCN0000330033 GACTCACTGGAAGAGATTTAT pLKO_005 2808 CDS 100% 15.000 10.500 N DLG3 n/a
4 TRCN0000361646 TGGGTTAAGTGACGATTATTA pLKO_005 2186 CDS 100% 15.000 10.500 N Dlg3 n/a
5 TRCN0000361716 GACCGGATCTTATCGGTAAAT pLKO_005 1692 CDS 100% 13.200 9.240 N Dlg3 n/a
6 TRCN0000361647 GTGACATTCTGCACGTCATTA pLKO_005 1993 CDS 100% 13.200 9.240 N Dlg3 n/a
7 TRCN0000024844 CCCTGGGTTAAGTGACGATTA pLKO.1 2183 CDS 100% 10.800 7.560 N Dlg3 n/a
8 TRCN0000024847 CCAAGTCCATTGAAGCACTTA pLKO.1 2680 CDS 100% 4.950 3.465 N Dlg3 n/a
9 TRCN0000024848 CGCAAGATCATCCTGCACAAA pLKO.1 1557 CDS 100% 4.950 3.465 N Dlg3 n/a
10 TRCN0000140912 CGCAAGATCATCCTGCACAAA pLKO.1 1557 CDS 100% 4.950 3.465 N DLG3 n/a
11 TRCN0000330105 CGCAAGATCATCCTGCACAAA pLKO_005 1557 CDS 100% 4.950 3.465 N DLG3 n/a
12 TRCN0000024845 CGGGAACAAATGGAGAAGGAT pLKO.1 2481 CDS 100% 3.000 2.100 N Dlg3 n/a
13 TRCN0000140857 CCAATGAAGGACCGAGTCAAT pLKO.1 2349 CDS 100% 4.950 3.960 N DLG3 n/a
14 TRCN0000330032 CCAATGAAGGACCGAGTCAAT pLKO_005 2349 CDS 100% 4.950 3.960 N DLG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016747.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00448 pDONR223 100% 89.5% 95.5% None (many diffs) n/a
2 ccsbBroad304_00448 pLX_304 0% 89.5% 95.5% V5 (many diffs) n/a
3 TRCN0000477451 GAAAAATTTTCGGACATAACTCAT pLX_317 19.1% 89.5% 95.5% V5 (many diffs) n/a
4 ccsbBroadEn_14616 pDONR223 100% 51.3% 22.2% None (many diffs) n/a
5 ccsbBroad304_14616 pLX_304 0% 51.3% 22.2% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000474898 GCATCTGGCTCATCTTTTACCAAT pLX_317 30.4% 51.3% 22.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV