Transcript: Human NM_017929.6

Homo sapiens peroxisomal biogenesis factor 26 (PEX26), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
PEX26 (55670)
Length:
18378
CDS:
140..1057

Additional Resources:

NCBI RefSeq record:
NM_017929.6
NBCI Gene record:
PEX26 (55670)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017929.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285361 ATGGAGCCTTGGCAGAATTTC pLKO_005 606 CDS 100% 13.200 9.240 N PEX26 n/a
2 TRCN0000275423 CTTCAGGTCAGGATGTTAATG pLKO_005 1388 3UTR 100% 13.200 9.240 N PEX26 n/a
3 TRCN0000275424 TGTCTCCTGGTGGTGAGATTT pLKO_005 926 CDS 100% 13.200 9.240 N PEX26 n/a
4 TRCN0000285360 TGGATCCGGAAGGCTGCATTT pLKO_005 1004 CDS 100% 10.800 7.560 N PEX26 n/a
5 TRCN0000157156 GAAATGGATCGGTGGCAAGAA pLKO.1 422 CDS 100% 4.950 3.465 N PEX26 n/a
6 TRCN0000157294 CAGTATTACCAGGTCCCTGAA pLKO.1 461 CDS 100% 4.050 2.835 N PEX26 n/a
7 TRCN0000157635 CTGGATGTACTTCAGGCCATT pLKO.1 716 CDS 100% 4.050 2.835 N PEX26 n/a
8 TRCN0000275422 CTGGATGTACTTCAGGCCATT pLKO_005 716 CDS 100% 4.050 2.835 N PEX26 n/a
9 TRCN0000156439 CTGGGTCCTTCAGTATTACCA pLKO.1 451 CDS 100% 3.000 1.800 N PEX26 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1498 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 10998 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1499 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 15970 3UTR 100% 10.800 5.400 Y SMIM11A n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2941 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2941 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017929.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15908 pDONR223 0% 99.8% 99.6% None 911G>A n/a
2 ccsbBroad304_15908 pLX_304 0% 99.8% 99.6% V5 911G>A n/a
3 ccsbBroadEn_08564 pDONR223 100% 99.8% 99.6% None 676T>C n/a
4 ccsbBroad304_08564 pLX_304 0% 99.8% 99.6% V5 676T>C n/a
Download CSV