Transcript: Human NM_018072.6

Homo sapiens HEAT repeat containing 1 (HEATR1), mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
HEATR1 (55127)
Length:
8459
CDS:
128..6562

Additional Resources:

NCBI RefSeq record:
NM_018072.6
NBCI Gene record:
HEATR1 (55127)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018072.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136697 GCTGAACAAGTCCGAATAGAA pLKO.1 3599 CDS 100% 5.625 7.875 N HEATR1 n/a
2 TRCN0000349726 GCTGAACAAGTCCGAATAGAA pLKO_005 3599 CDS 100% 5.625 7.875 N HEATR1 n/a
3 TRCN0000137162 GCTACCAGAATCCATTCCTTT pLKO.1 6433 CDS 100% 4.950 3.960 N HEATR1 n/a
4 TRCN0000312492 GCTACCAGAATCCATTCCTTT pLKO_005 6433 CDS 100% 4.950 3.960 N HEATR1 n/a
5 TRCN0000133839 CCCAGAACATTAGATGTTGTA pLKO.1 1436 CDS 100% 4.950 3.465 N HEATR1 n/a
6 TRCN0000137850 GCACAGATGGTTCTGGTTGTT pLKO.1 598 CDS 100% 4.950 3.465 N HEATR1 n/a
7 TRCN0000312432 GCACAGATGGTTCTGGTTGTT pLKO_005 598 CDS 100% 4.950 3.465 N HEATR1 n/a
8 TRCN0000137322 GCAGAGTTGATGGAAGATGAA pLKO.1 6458 CDS 100% 4.950 3.465 N HEATR1 n/a
9 TRCN0000349727 GCAGAGTTGATGGAAGATGAA pLKO_005 6458 CDS 100% 4.950 3.465 N HEATR1 n/a
10 TRCN0000138186 CCAGGTGATTCATCTGGAGAA pLKO.1 5479 CDS 100% 4.050 2.835 N HEATR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018072.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12163 pDONR223 100% 16.2% 16.1% None (many diffs) n/a
2 ccsbBroad304_12163 pLX_304 0% 16.2% 16.1% V5 (many diffs) n/a
3 TRCN0000473108 CCGTTACGCATCTTTGCGTAGGCT pLX_317 49.6% 16.2% 16.1% V5 (many diffs) n/a
4 ccsbBroadEn_12164 pDONR223 100% 5.5% 5.5% None 66T>C;361_6432del n/a
5 ccsbBroad304_12164 pLX_304 0% 5.5% 5.5% V5 66T>C;361_6432del n/a
6 TRCN0000467058 CCGGTGCGTTAATTACAAGCCTGG pLX_317 100% 5.5% 5.5% V5 66T>C;361_6432del n/a
Download CSV