Transcript: Human NM_018172.3

Homo sapiens family with sequence similarity 86 member C1 (FAM86C1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FAM86C1 (55199)
Length:
2111
CDS:
24..521

Additional Resources:

NCBI RefSeq record:
NM_018172.3
NBCI Gene record:
FAM86C1 (55199)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018172.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426475 TATGCTGGACTGGGATCAGAT pLKO_005 432 CDS 100% 4.950 3.465 N FAM86C1 n/a
2 TRCN0000422045 CACACTCGTTTCCTCACAAAG pLKO_005 901 3UTR 100% 10.800 6.480 N FAM86C1 n/a
3 TRCN0000444970 CTGAGCTGCTGCGGGATATTT pLKO_005 154 CDS 100% 15.000 7.500 Y EEF2KMT n/a
4 TRCN0000430453 AGAGCTTAGAAGCAAAGTTAA pLKO_005 118 CDS 100% 13.200 6.600 Y EEF2KMT n/a
5 TRCN0000168044 CCAACGGGATTGTGAGAATTA pLKO.1 551 3UTR 100% 13.200 6.600 Y FAM86C1 n/a
6 TRCN0000172901 GCCAGCAGTTCTGGTTCTTAA pLKO.1 724 3UTR 100% 13.200 6.600 Y EEF2KMT n/a
7 TRCN0000447299 TCTGAGCTGCTGCGGGATATT pLKO_005 153 CDS 100% 13.200 6.600 Y FAM86C1 n/a
8 TRCN0000427069 TTTATATGGGAAAGCGGATAA pLKO_005 594 3UTR 100% 10.800 5.400 Y FAM86C1 n/a
9 TRCN0000168498 GCAGAGCTTAGAAGCAAAGTT pLKO.1 116 CDS 100% 5.625 2.813 Y FAM86C1 n/a
10 TRCN0000167947 CTATTTGCTGACGTGCTGTAT pLKO.1 275 CDS 100% 4.950 2.475 Y FAM86C1 n/a
11 TRCN0000172453 CGAACTCTTGCTGCAGAGTTT pLKO.1 50 CDS 100% 0.495 0.248 Y FAM86C1 n/a
12 TRCN0000130496 GACCAGAAACTGTTTCCCTAT pLKO.1 473 CDS 100% 4.050 2.025 Y FAM86B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018172.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03547 pDONR223 100% 79.3% 79.3% None 159_260del n/a
2 ccsbBroad304_03547 pLX_304 0% 79.3% 79.3% V5 159_260del n/a
3 TRCN0000473048 AGTGCATTTCATCTCTGTAGCAAC pLX_317 92.4% 79.3% 79.3% V5 159_260del n/a
4 TRCN0000488399 TACCTGCGCGCCTAACAATCATGA pLX_317 37.3% 46.6% 27.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_09791 pDONR223 100% 46.4% 27.7% None (many diffs) n/a
6 ccsbBroad304_09791 pLX_304 0% 46.4% 27.7% V5 (many diffs) n/a
7 TRCN0000466174 GGAGAGATGACCTTCCATCATCTG pLX_317 21.3% 46.4% 27.7% V5 (many diffs) n/a
8 TRCN0000488297 ACTAGACGAAAAATGAGGCATGGA pLX_317 30.4% 46.4% 27.7% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000491961 CCGTTCATGATGGCGTAAGTACGC pLX_317 33.3% 39.7% 23.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV