Transcript: Human NM_018183.5

Homo sapiens strawberry notch homolog 1 (SBNO1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SBNO1 (55206)
Length:
11125
CDS:
148..4326

Additional Resources:

NCBI RefSeq record:
NM_018183.5
NBCI Gene record:
SBNO1 (55206)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018183.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050663 CCACGTAGAATTATACACAAT pLKO.1 3663 CDS 100% 4.950 6.930 N SBNO1 n/a
2 TRCN0000296456 TACCTACTCCAGCACTATTAA pLKO_005 356 CDS 100% 0.000 0.000 N SBNO1 n/a
3 TRCN0000050664 CCATTGATAATGGCTGGTTAT pLKO.1 995 CDS 100% 10.800 8.640 N SBNO1 n/a
4 TRCN0000296509 CATCAGCAGAATGCGTTATTT pLKO_005 3490 CDS 100% 15.000 10.500 N SBNO1 n/a
5 TRCN0000296455 ACCACGCAACATGGCCTATAT pLKO_005 1587 CDS 100% 13.200 9.240 N SBNO1 n/a
6 TRCN0000050667 CGACATGAAGATGAGGAGTTT pLKO.1 762 CDS 100% 4.950 3.465 N SBNO1 n/a
7 TRCN0000290067 CGACATGAAGATGAGGAGTTT pLKO_005 762 CDS 100% 4.950 3.465 N SBNO1 n/a
8 TRCN0000050665 CGCCAAGAGATAGTCCTTGTA pLKO.1 2222 CDS 100% 4.950 3.465 N SBNO1 n/a
9 TRCN0000290066 CGCCAAGAGATAGTCCTTGTA pLKO_005 2222 CDS 100% 4.950 3.465 N SBNO1 n/a
10 TRCN0000050666 GCTGGCTTCTTAATAGGTGAT pLKO.1 1087 CDS 100% 4.050 2.835 N SBNO1 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 9206 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 9207 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018183.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487978 ACGATCAAACATCGATTTGACGCC pLX_317 39.2% 20.1% 20.1% V5 (not translated due to prior stop codon) 1_3333del;3345T>C n/a
2 TRCN0000488167 CAGGTCATATCCGCTCTCATTATG pLX_317 36.5% 20.1% 20.1% V5 1_3333del;3345T>C;4176_4177insG n/a
3 ccsbBroadEn_13789 pDONR223 100% 12.3% 10.7% None (many diffs) n/a
4 ccsbBroad304_13789 pLX_304 0% 12.3% 10.7% V5 (many diffs) n/a
5 TRCN0000475304 ACTTTCCTTACCCGCGCTCCAGGC pLX_317 77.6% 12.3% 10.7% V5 (many diffs) n/a
Download CSV