Transcript: Human NM_018717.5

Homo sapiens mastermind like transcriptional coactivator 3 (MAML3), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
MAML3 (55534)
Length:
6844
CDS:
858..4274

Additional Resources:

NCBI RefSeq record:
NM_018717.5
NBCI Gene record:
MAML3 (55534)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018717.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236443 AGTACTGGGACCAACTAATAG pLKO_005 6379 3UTR 100% 13.200 18.480 N MAML3 n/a
2 TRCN0000063895 CCCAGGATATAGCAGCCGTAA pLKO.1 3280 CDS 100% 4.050 5.670 N MAML3 n/a
3 TRCN0000236446 GCCGCGAATGGCAGTAGTATT pLKO_005 885 CDS 100% 13.200 10.560 N MAML3 n/a
4 TRCN0000236442 GGAGCTCGATCACCACTTAAT pLKO_005 1356 CDS 100% 13.200 10.560 N MAML3 n/a
5 TRCN0000236445 GATCAATCAGCAGCCAAATAA pLKO_005 2588 CDS 100% 15.000 10.500 N MAML3 n/a
6 TRCN0000243593 TTGGGTACAAACTCCTTAAAC pLKO_005 2610 CDS 100% 13.200 9.240 N Maml3 n/a
7 TRCN0000236444 TGGGCTTCTAGAAGATCTAAG pLKO_005 1568 CDS 100% 10.800 7.560 N MAML3 n/a
8 TRCN0000063893 GCCAAATAACTTGGGTACAAA pLKO.1 2600 CDS 100% 5.625 3.938 N MAML3 n/a
9 TRCN0000063897 CATCAACAATTTGCCCAGTAA pLKO.1 1463 CDS 100% 4.950 3.465 N MAML3 n/a
10 TRCN0000063896 CCCAAGCCTTTAACAACCAAA pLKO.1 2488 CDS 100% 4.950 3.465 N MAML3 n/a
11 TRCN0000063894 GTGTGAATAATACTCCCAATA pLKO.1 952 CDS 100% 10.800 6.480 N MAML3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018717.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000481450 TCCCCATCCTGAACCATTGGTTAA pLX_317 13.3% 99.4% 99.5% V5 (many diffs) n/a
2 ccsbBroadEn_14200 pDONR223 100% 99.4% 91.6% None (many diffs) n/a
3 ccsbBroad304_14200 pLX_304 0% 99.4% 91.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV