Transcript: Human NM_019076.4

Homo sapiens UDP glucuronosyltransferase family 1 member A8 (UGT1A8), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
UGT1A8 (54576)
Length:
2396
CDS:
64..1656

Additional Resources:

NCBI RefSeq record:
NM_019076.4
NBCI Gene record:
UGT1A8 (54576)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019076.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437257 GGATTTCGCCGATGCTCAATG pLKO_005 336 CDS 100% 10.800 7.560 N UGT1A8 n/a
2 TRCN0000036434 GCACAAGTACGAAGTTTGTTT pLKO.1 361 CDS 100% 5.625 3.938 N UGT1A8 n/a
3 TRCN0000036437 GCTTGCCACTATCTTGAAGAA pLKO.1 580 CDS 100% 4.950 3.465 N UGT1A8 n/a
4 TRCN0000436577 TGCGGTGTTTCTTGATCCTTT pLKO_005 492 CDS 100% 4.950 3.465 N UGT1A8 n/a
5 TRCN0000036436 TCTATTTCTGAGTTCATCCAA pLKO.1 384 CDS 100% 3.000 2.100 N UGT1A8 n/a
6 TRCN0000036435 CCTATGTGTTTCTCTGCTGCT pLKO.1 96 CDS 100% 2.160 1.512 N UGT1A8 n/a
7 TRCN0000429851 AGTGGCCTTCATCACCTTTAA pLKO_005 1557 CDS 100% 13.200 6.600 Y UGT1A6 n/a
8 TRCN0000036408 GCATTGCAGGAGTTTGTTTAA pLKO.1 429 CDS 100% 13.200 6.600 Y UGT1A10 n/a
9 TRCN0000433060 GGAATTTGAAGCCTACATTAA pLKO_005 918 CDS 100% 13.200 6.600 Y UGT1A8 n/a
10 TRCN0000415437 GTCGGTGGTGGAGAAACTTAT pLKO_005 189 CDS 100% 13.200 6.600 Y UGT1A8 n/a
11 TRCN0000365387 TGAACCATTCCCTAGTCATTT pLKO_005 1685 3UTR 100% 13.200 6.600 Y UGT1A7 n/a
12 TRCN0000370491 TGGAATTTGAAGCCTACATTA pLKO_005 917 CDS 100% 13.200 6.600 Y UGT1A7 n/a
13 TRCN0000370492 ACCATTCCTTGGACGTGATTG pLKO_005 1511 CDS 100% 10.800 5.400 Y UGT1A7 n/a
14 TRCN0000432861 ATGGTTGCAATTGATCCTTAA pLKO_005 2047 3UTR 100% 10.800 5.400 Y UGT1A6 n/a
15 TRCN0000428119 GAGAAGAAAGCTATGGCAATT pLKO_005 1000 CDS 100% 10.800 5.400 Y UGT1A6 n/a
16 TRCN0000443915 GCAAAGCGCATGGAGACTAAG pLKO_005 1255 CDS 100% 10.800 5.400 Y UGT1A6 n/a
17 TRCN0000370426 GTGCTTATGGCTACCGGAAAT pLKO_005 1583 CDS 100% 10.800 5.400 Y UGT1A7 n/a
18 TRCN0000414229 GTGGGTGGGAAATAAGGTAAA pLKO_005 1660 3UTR 100% 10.800 5.400 Y UGT1A8 n/a
19 TRCN0000445577 TTGGGAGTGCGGGATTCAAAG pLKO_005 1964 3UTR 100% 10.800 5.400 Y UGT1A6 n/a
20 TRCN0000429759 ATGACTTCTGAAGATTTAGAA pLKO_005 1306 CDS 100% 5.625 2.813 Y UGT1A6 n/a
21 TRCN0000036405 CCATTGCCTATGGAATTTGAA pLKO.1 907 CDS 100% 5.625 2.813 Y UGT1A10 n/a
22 TRCN0000441648 GCTGGAGTGACCCTGAATGTT pLKO_005 1279 CDS 100% 5.625 2.813 Y UGT1A6 n/a
23 TRCN0000418714 AGTTACAAGGAGAACATCATG pLKO_005 1357 CDS 100% 4.950 2.475 Y UGT1A6 n/a
24 TRCN0000036407 CACCTTTAAATGTTGTGCTTA pLKO.1 1569 CDS 100% 4.950 2.475 Y UGT1A10 n/a
25 TRCN0000034773 CATGGTGTTTATGAAAGCATA pLKO.1 1180 CDS 100% 4.950 2.475 Y UGT1A6 n/a
26 TRCN0000034654 CCCTAGAAATAGCCTCTGAAA pLKO.1 743 CDS 100% 4.950 2.475 Y UGT1A9 n/a
27 TRCN0000029531 CGAGTTAAGAAAGCCCACAAA pLKO.1 1621 CDS 100% 4.950 2.475 Y UGT1A1 n/a
28 TRCN0000034543 GAAGACTTACTCAACCTCATA pLKO.1 285 CDS 100% 4.950 2.475 Y UGT1A7 n/a
29 TRCN0000036438 GCACAGTGAAGACTTACTCAA pLKO.1 278 CDS 100% 4.950 2.475 Y UGT1A8 n/a
30 TRCN0000436928 ATCTGCTTGGTCACCCGATGA pLKO_005 1130 CDS 100% 4.050 2.025 Y UGT1A6 n/a
31 TRCN0000034772 CCCACAAATCCAAGACCCATT pLKO.1 1634 CDS 100% 4.050 2.025 Y UGT1A6 n/a
32 TRCN0000034771 GCGAACAACACGATACTTGTT pLKO.1 1090 CDS 100% 0.495 0.248 Y UGT1A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019076.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14164 pDONR223 100% 96.6% 93.7% None (many diffs) n/a
2 ccsbBroad304_14164 pLX_304 0% 96.6% 93.7% V5 (not translated due to frame shift) (many diffs) n/a
3 ccsbBroadEn_03441 pDONR223 100% 96.4% 94.9% None (many diffs) n/a
4 ccsbBroad304_03441 pLX_304 0% 96.4% 94.9% V5 (many diffs) n/a
5 TRCN0000468494 AAATCATCCCCTACTGAATCTAAA pLX_317 27.9% 96.4% 94.9% V5 (many diffs) n/a
6 ccsbBroadEn_12061 pDONR223 100% 79.3% 76.2% None (many diffs) n/a
7 ccsbBroad304_12061 pLX_304 0% 79.3% 76.2% V5 (many diffs) n/a
8 TRCN0000473076 TAAGACGCAAGTTAAATATGTTAT pLX_317 25.3% 79.3% 76.2% V5 (many diffs) n/a
Download CSV