Transcript: Mouse NM_019927.2

Mus musculus ariadne RBR E3 ubiquitin protein ligase 1 (Arih1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Arih1 (23806)
Length:
6435
CDS:
28..1695

Additional Resources:

NCBI RefSeq record:
NM_019927.2
NBCI Gene record:
Arih1 (23806)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007502 GCTACCTTGAACGAGATATTT pLKO.1 1541 CDS 100% 15.000 21.000 N ARIH1 n/a
2 TRCN0000284843 GCTACCTTGAACGAGATATTT pLKO_005 1541 CDS 100% 15.000 21.000 N ARIH1 n/a
3 TRCN0000294688 GCTACCTTGAACGAGATATTT pLKO_005 1541 CDS 100% 15.000 21.000 N Arih1 n/a
4 TRCN0000272750 GAACTACCCTAACTCGTATTT pLKO_005 594 CDS 100% 13.200 18.480 N ARIH1 n/a
5 TRCN0000041009 CCAGTCCATTATCTTTGAGAA pLKO.1 1479 CDS 100% 4.950 6.930 N Arih1 n/a
6 TRCN0000298302 CCAGTCCATTATCTTTGAGAA pLKO_005 1479 CDS 100% 4.950 6.930 N Arih1 n/a
7 TRCN0000294649 TAGAGTGCTCATGCAATTAAA pLKO_005 1737 3UTR 100% 15.000 10.500 N Arih1 n/a
8 TRCN0000041008 CCAGCAACTATCACGAGAATA pLKO.1 400 CDS 100% 13.200 9.240 N Arih1 n/a
9 TRCN0000298306 CCAGCAACTATCACGAGAATA pLKO_005 400 CDS 100% 13.200 9.240 N Arih1 n/a
10 TRCN0000284842 GCCACTTCAATTGGGATAAAG pLKO_005 428 CDS 100% 13.200 9.240 N ARIH1 n/a
11 TRCN0000272751 TTCTACTGTAATCGCTATATG pLKO_005 1267 CDS 100% 13.200 9.240 N ARIH1 n/a
12 TRCN0000007501 GCCAGATGAATACAAGGTCAT pLKO.1 539 CDS 100% 4.050 2.835 N ARIH1 n/a
13 TRCN0000007500 CCATCTAGAGTGCTCATGCAA pLKO.1 1732 3UTR 100% 3.000 2.100 N ARIH1 n/a
14 TRCN0000041012 CCAGAACTGTAAAGCAGAATT pLKO.1 1113 CDS 100% 0.000 0.000 N Arih1 n/a
15 TRCN0000298304 CCAGAACTGTAAAGCAGAATT pLKO_005 1113 CDS 100% 0.000 0.000 N Arih1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02863 pDONR223 100% 95.5% 99.1% None (many diffs) n/a
2 ccsbBroad304_02863 pLX_304 0% 95.5% 99.1% V5 (many diffs) n/a
3 TRCN0000477092 CGAGGCATACCAAGAAGTTTAGTC pLX_317 23.6% 95.5% 99.1% V5 (many diffs) n/a
Download CSV