Transcript: Human NM_020394.5

Homo sapiens zinc finger protein 695 (ZNF695), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZNF695 (57116)
Length:
3341
CDS:
150..1697

Additional Resources:

NCBI RefSeq record:
NM_020394.5
NBCI Gene record:
ZNF695 (57116)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020394.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435421 GGTTCAACACCTCCACTTATA pLKO_005 1878 3UTR 100% 13.200 10.560 N ZNF695 n/a
2 TRCN0000425057 TAACCTGTGCTCAGTTCTTAC pLKO_005 980 CDS 100% 10.800 7.560 N ZNF695 n/a
3 TRCN0000412585 TTAATGAGTGCTCATGCTTTA pLKO_005 811 CDS 100% 10.800 7.560 N ZNF695 n/a
4 TRCN0000430531 ACAGCAGAGAATCCATATTGG pLKO_005 752 CDS 100% 4.950 3.465 N ZNF695 n/a
5 TRCN0000417358 AGTTGTTCCCATACCTTACTC pLKO_005 1066 CDS 100% 4.950 3.465 N ZNF695 n/a
6 TRCN0000107474 CCTATTTCACAGTCTTGCTAT pLKO.1 305 CDS 100% 4.950 3.465 N ZNF695 n/a
7 TRCN0000418109 GCAATGTCTCTTGCATGTCTT pLKO_005 718 CDS 100% 4.950 3.465 N ZNF695 n/a
8 TRCN0000107471 GCTTCAATATGCAATTCCTAT pLKO.1 289 CDS 100% 4.950 3.465 N ZNF695 n/a
9 TRCN0000422099 TTGTTGTCATACCTTACTCAA pLKO_005 1152 CDS 100% 4.950 3.465 N ZNF695 n/a
10 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1441 CDS 100% 13.200 6.600 Y Zfp934 n/a
11 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1441 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
12 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1441 CDS 100% 13.200 6.600 Y EG668616 n/a
13 TRCN0000413158 CTTATCTTACTGAAGACATTT pLKO_005 418 CDS 100% 13.200 6.600 Y ZNF695 n/a
14 TRCN0000435505 ACCCTACAAATGTGATGAATG pLKO_005 1451 CDS 100% 10.800 5.400 Y ZNF678 n/a
15 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 245 CDS 100% 4.950 2.475 Y ZNF493 n/a
16 TRCN0000107472 CGCTTAAGGAATGACTGGGAA pLKO.1 516 CDS 100% 2.640 1.320 Y ZNF695 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020394.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12330 pDONR223 100% 30.7% 26.4% None (many diffs) n/a
2 ccsbBroad304_12330 pLX_304 0% 30.7% 26.4% V5 (many diffs) n/a
3 TRCN0000465790 ATTTCATTACTAATATTCAGCCAT pLX_317 60.4% 30.7% 26.4% V5 (many diffs) n/a
4 ccsbBroadEn_15936 pDONR223 0% 25.4% 25% None (many diffs) n/a
5 ccsbBroad304_15936 pLX_304 0% 25.4% 25% V5 (many diffs) n/a
6 TRCN0000471219 TTCTAAAATCCCTGGAGTTCTTAT pLX_317 100% 25.4% 25% V5 (many diffs) n/a
7 ccsbBroadEn_15935 pDONR223 0% 16.8% 16.5% None 251G>A;260_262delTTTinsCCA;265_1545del n/a
8 ccsbBroad304_15935 pLX_304 0% 16.8% 16.5% V5 251G>A;260_262delTTTinsCCA;265_1545del n/a
9 TRCN0000470953 TCTCCTGAACACTATGAGACCGTA pLX_317 100% 16.8% 16.5% V5 251G>A;260_262delTTTinsCCA;265_1545del n/a
Download CSV