Transcript: Human NM_020441.3

Homo sapiens coronin 1B (CORO1B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
CORO1B (57175)
Length:
4411
CDS:
76..1545

Additional Resources:

NCBI RefSeq record:
NM_020441.3
NBCI Gene record:
CORO1B (57175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116423 CCTCACAACGACGAAGTCATA pLKO.1 349 CDS 100% 4.950 6.930 N CORO1B n/a
2 TRCN0000289792 CCTCACAACGACGAAGTCATA pLKO_005 349 CDS 100% 4.950 6.930 N CORO1B n/a
3 TRCN0000116426 CGTGGTACTCATCTGGAATGT pLKO.1 540 CDS 100% 4.950 3.465 N CORO1B n/a
4 TRCN0000289790 CGTGGTACTCATCTGGAATGT pLKO_005 540 CDS 100% 4.950 3.465 N CORO1B n/a
5 TRCN0000116425 GTCAAGAACGACCAGTGCTAT pLKO.1 133 CDS 100% 4.950 3.465 N CORO1B n/a
6 TRCN0000289724 GTCAAGAACGACCAGTGCTAT pLKO_005 133 CDS 100% 4.950 3.465 N CORO1B n/a
7 TRCN0000116424 GCCCGGTTCTACAAACTGCAT pLKO.1 1078 CDS 100% 2.640 1.848 N CORO1B n/a
8 TRCN0000289725 GCCCGGTTCTACAAACTGCAT pLKO_005 1078 CDS 100% 2.640 1.848 N CORO1B n/a
9 TRCN0000116422 CGCCCAGCTTTCCTCACTGTT pLKO.1 1703 3UTR 100% 1.650 1.155 N CORO1B n/a
10 TRCN0000289726 CGCCCAGCTTTCCTCACTGTT pLKO_005 1703 3UTR 100% 1.650 1.155 N CORO1B n/a
11 TRCN0000052773 ACAGGCATCAGGCAACCATTT pLKO.1 4367 3UTR 100% 10.800 5.400 Y PTPRCAP n/a
12 TRCN0000367393 ATGAGCAGGACACAGACTATG pLKO_005 3893 3UTR 100% 10.800 5.400 Y PTPRCAP n/a
13 TRCN0000367437 TCCATGTCACCGCACTGTAGA pLKO_005 4169 3UTR 100% 4.950 2.475 Y PTPRCAP n/a
14 TRCN0000052774 TGAGCAGGACACAGACTATGA pLKO.1 3894 3UTR 100% 4.950 2.475 Y PTPRCAP n/a
15 TRCN0000367450 GGTCCACAGACAATGACCTTG pLKO_005 3860 3UTR 100% 4.050 2.025 Y PTPRCAP n/a
16 TRCN0000377213 TGAGTGACCTGCACGCCTTTG pLKO_005 4097 3UTR 100% 2.000 1.000 Y PTPRCAP n/a
17 TRCN0000052776 GAAGGCGAGCAGCAATGTGGA pLKO.1 3952 3UTR 100% 0.880 0.440 Y PTPRCAP n/a
18 TRCN0000052775 TGAGCGACAGGAGGATGAGCA pLKO.1 3879 3UTR 100% 0.880 0.440 Y PTPRCAP n/a
19 TRCN0000052777 CTCTGTCACCGTTGTCCTGCT pLKO.1 3663 3UTR 100% 0.720 0.360 Y PTPRCAP n/a
20 TRCN0000090024 CCCTACATCCACTTCCTGAAT pLKO.1 979 CDS 100% 4.950 3.465 N Coro1b n/a
21 TRCN0000326503 CCCTACATCCACTTCCTGAAT pLKO_005 979 CDS 100% 4.950 3.465 N Coro1b n/a
22 TRCN0000090027 CGGTACTTTGAGATCACAGAT pLKO.1 952 CDS 100% 4.950 3.465 N Coro1b n/a
23 TRCN0000326571 CGGTACTTTGAGATCACAGAT pLKO_005 952 CDS 100% 4.950 3.465 N Coro1b n/a
24 TRCN0000220422 GCCCTGCTGAGTGACCTGCAT pLKO.1 4090 3UTR 100% 0.000 0.000 Y Ptprcap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03800 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03800 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480922 TAACAATTTGGTCCCATTGATGCA pLX_317 27.3% 100% 100% V5 n/a
Download CSV