Transcript: Human NM_020474.3

Homo sapiens polypeptide N-acetylgalactosaminyltransferase 1 (GALNT1), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
GALNT1 (2589)
Length:
3852
CDS:
95..1774

Additional Resources:

NCBI RefSeq record:
NM_020474.3
NBCI Gene record:
GALNT1 (2589)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020474.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303374 GACGTGAAACTGCATAGTAAT pLKO_005 1964 3UTR 100% 13.200 18.480 N GALNT1 n/a
2 TRCN0000310411 ATTGATCAGAGCTAGATTAAA pLKO_005 658 CDS 100% 15.000 10.500 N GALNT1 n/a
3 TRCN0000035607 GTTAGGTTAGAAGGGTGTAAA pLKO.1 395 CDS 100% 13.200 9.240 N GALNT1 n/a
4 TRCN0000291913 GTTAGGTTAGAAGGGTGTAAA pLKO_005 395 CDS 100% 13.200 9.240 N GALNT1 n/a
5 TRCN0000035604 CCAAACTTAATGGCCCAGTTA pLKO.1 1551 CDS 100% 4.950 3.465 N GALNT1 n/a
6 TRCN0000035606 CCAAGACACATGATAGAAGAA pLKO.1 524 CDS 100% 4.950 3.465 N GALNT1 n/a
7 TRCN0000110294 CCAGGTGTTACAAAGGTAGAT pLKO.1 1250 CDS 100% 4.950 3.465 N Galnt1 n/a
8 TRCN0000335091 CCAGGTGTTACAAAGGTAGAT pLKO_005 1250 CDS 100% 4.950 3.465 N Galnt1 n/a
9 TRCN0000035605 CCCAGCATTAGAGACTGCAAT pLKO.1 1697 CDS 100% 4.950 3.465 N GALNT1 n/a
10 TRCN0000291912 CCCAGCATTAGAGACTGCAAT pLKO_005 1697 CDS 100% 4.950 3.465 N GALNT1 n/a
11 TRCN0000110293 CCCAGTGAAATTAACCCTGCA pLKO.1 1621 CDS 100% 2.160 1.512 N Galnt1 n/a
12 TRCN0000335092 CCCAGTGAAATTAACCCTGCA pLKO_005 1621 CDS 100% 2.160 1.512 N Galnt1 n/a
13 TRCN0000035608 GCTTGGATGTTTCCAAACTTA pLKO.1 1539 CDS 100% 0.563 0.394 N GALNT1 n/a
14 TRCN0000291911 GCTTGGATGTTTCCAAACTTA pLKO_005 1539 CDS 100% 0.563 0.394 N GALNT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020474.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488736 TGCGTGTCCTTAACCATCACACGT pLX_317 20.9% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000487916 ATAACTACTAGACCTGACTGATGA pLX_317 18.7% 99.9% 99.8% V5 1677_1678insG n/a
3 ccsbBroadEn_15423 pDONR223 0% 18.7% 18.7% None 316_1677del n/a
4 ccsbBroad304_15423 pLX_304 0% 18.7% 18.7% V5 316_1677del n/a
5 TRCN0000465537 TCAACCGGGCACGCAACGACACAA pLX_317 79.4% 18.7% 18.7% V5 316_1677del n/a
Download CSV