Transcript: Mouse NM_020600.4

Mus musculus ribosomal protein S14 (Rps14), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rps14 (20044)
Length:
606
CDS:
94..549

Additional Resources:

NCBI RefSeq record:
NM_020600.4
NBCI Gene record:
Rps14 (20044)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_020600.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104363 CGAGATGAGTCCTCTCCATAT pLKO.1 289 CDS 100% 10.800 7.560 N Rps14 n/a
2 TRCN0000104360 CCGATCTTTCTGGCAAGGAAA pLKO.1 227 CDS 100% 4.950 2.970 N Rps14 n/a
3 TRCN0000104364 CCACATCTTTGCATCCTTCAA pLKO.1 186 CDS 100% 4.950 2.475 Y Rps14 n/a
4 TRCN0000104361 GCATCCTTCAATGACACCTTT pLKO.1 196 CDS 100% 4.950 2.475 Y Rps14 n/a
5 TRCN0000104362 GCTGAGGGAGAGAATGTGTTT pLKO.1 157 CDS 100% 4.950 2.475 Y Rps14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020600.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01453 pDONR223 100% 92% 100% None (many diffs) n/a
2 ccsbBroad304_01453 pLX_304 0% 92% 100% V5 (many diffs) n/a
3 TRCN0000474672 TCGAGGCCCTACGTCGTCGGATGC pLX_317 86% 92% 100% V5 (many diffs) n/a
4 ccsbBroadEn_06898 pDONR223 100% 91.8% 100% None (many diffs) n/a
5 ccsbBroad304_06898 pLX_304 0% 91.8% 100% V5 (many diffs) n/a
6 TRCN0000469971 GTGATTATTTTGCAAATCCTTAAA pLX_317 94.5% 91.8% 100% V5 (many diffs) n/a
7 ccsbBroadEn_13722 pDONR223 100% 78.8% 76.1% None (many diffs) n/a
8 ccsbBroad304_13722 pLX_304 0% 78.8% 76.1% V5 (many diffs) n/a
9 TRCN0000480995 GGACTGCTTCGCGGTTAGATGTGG pLX_317 70% 78.8% 76.1% V5 (many diffs) n/a
Download CSV