Transcript: Human NM_020651.4

Homo sapiens pellino E3 ubiquitin protein ligase 1 (PELI1), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
PELI1 (57162)
Length:
3716
CDS:
410..1666

Additional Resources:

NCBI RefSeq record:
NM_020651.4
NBCI Gene record:
PELI1 (57162)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020651.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414395 CCCTTTACAGCACGGATTTAT pLKO_005 851 CDS 100% 15.000 21.000 N PELI1 n/a
2 TRCN0000155003 GCACCACAAGTATAGACAGTT pLKO.1 2934 3UTR 100% 4.950 6.930 N PELI1 n/a
3 TRCN0000413621 CTCATTGTCTTAGGGTATAAT pLKO_005 467 CDS 100% 15.000 10.500 N PELI1 n/a
4 TRCN0000430893 TTACAAGATGGCTCGTTAATT pLKO_005 1121 CDS 100% 15.000 10.500 N PELI1 n/a
5 TRCN0000151830 CCATGTACATGGCTATCATAA pLKO.1 1345 CDS 100% 13.200 9.240 N PELI1 n/a
6 TRCN0000420488 GACCAGCATAGCATATCATAT pLKO_005 626 CDS 100% 13.200 9.240 N PELI1 n/a
7 TRCN0000179339 GCACTGTGCATATTGCTTGTA pLKO.1 573 CDS 100% 4.950 3.465 N PELI1 n/a
8 TRCN0000155258 GCCAAATGGAAGACATCAGAT pLKO.1 920 CDS 100% 4.950 2.970 N PELI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020651.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08714 pDONR223 100% 99.8% 100% None 243A>G;291C>A n/a
2 ccsbBroad304_08714 pLX_304 0% 99.8% 100% V5 243A>G;291C>A n/a
3 TRCN0000478265 GCACACGGTGTACATGGGCGCGGA pLX_317 17.5% 99.8% 100% V5 243A>G;291C>A n/a
4 ccsbBroadEn_15942 pDONR223 0% 29.9% 29.9% None 1_879del n/a
5 ccsbBroad304_15942 pLX_304 0% 29.9% 29.9% V5 1_879del n/a
6 TRCN0000474918 GTACTAACTACGACCGGACATTTC pLX_317 100% 29.9% 29.9% V5 1_879del n/a
Download CSV