Transcript: Human NM_020742.3

Homo sapiens neuroligin 4 X-linked (NLGN4X), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
NLGN4X (57502)
Length:
5706
CDS:
465..2915

Additional Resources:

NCBI RefSeq record:
NM_020742.3
NBCI Gene record:
NLGN4X (57502)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020742.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047123 CCTGCGGAACAAGAACTACAA pLKO.1 1415 CDS 100% 4.950 3.465 N NLGN4X n/a
2 TRCN0000047125 CCCACGGAAGATGATATTCAT pLKO.1 924 CDS 100% 5.625 3.375 N NLGN4X n/a
3 TRCN0000075268 GCCAGCCTGAACTATATTTAA pLKO.1 3498 3UTR 100% 15.000 7.500 Y NLGN4Y n/a
4 TRCN0000047124 CGAGATTATTCCACCGAATTA pLKO.1 2469 CDS 100% 13.200 6.600 Y NLGN4X n/a
5 TRCN0000047126 GCACAACTTGAACGAGATATT pLKO.1 2255 CDS 100% 13.200 6.600 Y NLGN4X n/a
6 TRCN0000047127 CGTCTGGGAATACTAGGGTTT pLKO.1 1074 CDS 100% 4.050 2.025 Y NLGN4X n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020742.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11630 pDONR223 100% 11.8% 10.3% None (many diffs) n/a
2 ccsbBroad304_11630 pLX_304 0% 11.8% 10.3% V5 (many diffs) n/a
3 TRCN0000472048 CAAATAGGCCTTTCAACCGACTGA pLX_317 100% 11.8% 10.3% V5 (many diffs) n/a
Download CSV