Transcript: Human NM_020800.3

Homo sapiens intraflagellar transport 80 (IFT80), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
IFT80 (57560)
Length:
3999
CDS:
127..2460

Additional Resources:

NCBI RefSeq record:
NM_020800.3
NBCI Gene record:
IFT80 (57560)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020800.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133680 GCTGGTGAAGACTGTAAATAT pLKO.1 742 CDS 100% 15.000 7.500 Y IFT80 n/a
2 TRCN0000137720 GCAGGCAAGCAGCTAATCATT pLKO.1 622 CDS 100% 5.625 2.813 Y IFT80 n/a
3 TRCN0000193055 CCAAGTTAGGAAGAGTGGAAA pLKO.1 404 CDS 100% 4.950 2.475 Y Ift80 n/a
4 TRCN0000345148 CCAAGTTAGGAAGAGTGGAAA pLKO_005 404 CDS 100% 4.950 2.475 Y Ift80 n/a
5 TRCN0000134272 GCAGTGTACTTACAAGTTGTA pLKO.1 3843 3UTR 100% 4.950 2.475 Y IFT80 n/a
6 TRCN0000134706 GCGCTTTATTTCATCTCCAAA pLKO.1 1329 CDS 100% 4.950 2.475 Y IFT80 n/a
7 TRCN0000137906 GCTGTGAGACTTTGTCGCTTT pLKO.1 1936 CDS 100% 4.050 2.025 Y IFT80 n/a
8 TRCN0000135575 GCAGCATTACTGGAATAGCAA pLKO.1 2940 3UTR 100% 3.000 1.500 Y IFT80 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020800.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03831 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03831 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465441 CCTGACTAGTTGCCCATCCCATAG pLX_317 16.1% 100% 100% V5 n/a
4 ccsbBroadEn_13795 pDONR223 100% 74.6% 67.2% None (many diffs) n/a
5 ccsbBroad304_13795 pLX_304 0% 74.6% 67.2% V5 (many diffs) n/a
6 TRCN0000472584 TCCGTTTATTTAGTTGATAAGTTG pLX_317 13.3% 74.6% 67.2% V5 (many diffs) n/a
Download CSV