Transcript: Human NM_021027.3

Homo sapiens UDP glucuronosyltransferase family 1 member A9 (UGT1A9), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
UGT1A9 (54600)
Length:
2371
CDS:
38..1630

Additional Resources:

NCBI RefSeq record:
NM_021027.3
NBCI Gene record:
UGT1A9 (54600)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021027.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034656 GCACAAGTACGAAGTATATAT pLKO.1 335 CDS 100% 15.000 10.500 N UGT1A9 n/a
2 TRCN0000433772 CAAACACCTGTTACGGAGTAT pLKO_005 743 CDS 100% 4.950 3.465 N UGT1A9 n/a
3 TRCN0000034655 ACATTTATTATGCCACCGTTT pLKO.1 685 CDS 100% 4.050 2.835 N UGT1A9 n/a
4 TRCN0000034657 ACTTCATATACCCTGGAGGAT pLKO.1 272 CDS 100% 2.640 1.848 N UGT1A9 n/a
5 TRCN0000034658 CCGTTGCCTATGGAATTTGAA pLKO.1 881 CDS 100% 5.625 3.375 N UGT1A9 n/a
6 TRCN0000426546 CAGGAGTTTGTTTAAAGACAA pLKO_005 409 CDS 100% 4.950 2.970 N UGT1A9 n/a
7 TRCN0000429851 AGTGGCCTTCATCACCTTTAA pLKO_005 1531 CDS 100% 13.200 6.600 Y UGT1A6 n/a
8 TRCN0000433060 GGAATTTGAAGCCTACATTAA pLKO_005 892 CDS 100% 13.200 6.600 Y UGT1A8 n/a
9 TRCN0000365387 TGAACCATTCCCTAGTCATTT pLKO_005 1659 3UTR 100% 13.200 6.600 Y UGT1A7 n/a
10 TRCN0000370491 TGGAATTTGAAGCCTACATTA pLKO_005 891 CDS 100% 13.200 6.600 Y UGT1A7 n/a
11 TRCN0000370492 ACCATTCCTTGGACGTGATTG pLKO_005 1485 CDS 100% 10.800 5.400 Y UGT1A7 n/a
12 TRCN0000432861 ATGGTTGCAATTGATCCTTAA pLKO_005 2021 3UTR 100% 10.800 5.400 Y UGT1A6 n/a
13 TRCN0000428119 GAGAAGAAAGCTATGGCAATT pLKO_005 974 CDS 100% 10.800 5.400 Y UGT1A6 n/a
14 TRCN0000443915 GCAAAGCGCATGGAGACTAAG pLKO_005 1229 CDS 100% 10.800 5.400 Y UGT1A6 n/a
15 TRCN0000370426 GTGCTTATGGCTACCGGAAAT pLKO_005 1557 CDS 100% 10.800 5.400 Y UGT1A7 n/a
16 TRCN0000414229 GTGGGTGGGAAATAAGGTAAA pLKO_005 1634 3UTR 100% 10.800 5.400 Y UGT1A8 n/a
17 TRCN0000445577 TTGGGAGTGCGGGATTCAAAG pLKO_005 1938 3UTR 100% 10.800 5.400 Y UGT1A6 n/a
18 TRCN0000429759 ATGACTTCTGAAGATTTAGAA pLKO_005 1280 CDS 100% 5.625 2.813 Y UGT1A6 n/a
19 TRCN0000441648 GCTGGAGTGACCCTGAATGTT pLKO_005 1253 CDS 100% 5.625 2.813 Y UGT1A6 n/a
20 TRCN0000418714 AGTTACAAGGAGAACATCATG pLKO_005 1331 CDS 100% 4.950 2.475 Y UGT1A6 n/a
21 TRCN0000036407 CACCTTTAAATGTTGTGCTTA pLKO.1 1543 CDS 100% 4.950 2.475 Y UGT1A10 n/a
22 TRCN0000034773 CATGGTGTTTATGAAAGCATA pLKO.1 1154 CDS 100% 4.950 2.475 Y UGT1A6 n/a
23 TRCN0000034654 CCCTAGAAATAGCCTCTGAAA pLKO.1 717 CDS 100% 4.950 2.475 Y UGT1A9 n/a
24 TRCN0000029531 CGAGTTAAGAAAGCCCACAAA pLKO.1 1595 CDS 100% 4.950 2.475 Y UGT1A1 n/a
25 TRCN0000436928 ATCTGCTTGGTCACCCGATGA pLKO_005 1104 CDS 100% 4.050 2.025 Y UGT1A6 n/a
26 TRCN0000034772 CCCACAAATCCAAGACCCATT pLKO.1 1608 CDS 100% 4.050 2.025 Y UGT1A6 n/a
27 TRCN0000034771 GCGAACAACACGATACTTGTT pLKO.1 1064 CDS 100% 0.495 0.248 Y UGT1A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021027.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03441 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03441 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468494 AAATCATCCCCTACTGAATCTAAA pLX_317 27.9% 100% 100% V5 n/a
4 ccsbBroadEn_14164 pDONR223 100% 95.5% 92.4% None (many diffs) n/a
5 ccsbBroad304_14164 pLX_304 0% 95.5% 92.4% V5 (not translated due to frame shift) (many diffs) n/a
6 ccsbBroadEn_12061 pDONR223 100% 78.2% 74.9% None (many diffs) n/a
7 ccsbBroad304_12061 pLX_304 0% 78.2% 74.9% V5 (many diffs) n/a
8 TRCN0000473076 TAAGACGCAAGTTAAATATGTTAT pLX_317 25.3% 78.2% 74.9% V5 (many diffs) n/a
Download CSV