Transcript: Human NM_021187.3

Homo sapiens cytochrome P450 family 4 subfamily F member 11 (CYP4F11), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
CYP4F11 (57834)
Length:
3395
CDS:
459..2033

Additional Resources:

NCBI RefSeq record:
NM_021187.3
NBCI Gene record:
CYP4F11 (57834)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021187.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416693 CAATATTATCGGGATCCATTA pLKO_005 1724 CDS 100% 10.800 15.120 N CYP4F11 n/a
2 TRCN0000064206 GTCGCACCCAAGGATATGATT pLKO.1 807 CDS 100% 5.625 4.500 N CYP4F11 n/a
3 TRCN0000420323 GATGTTGCACGCAGGACTTTG pLKO_005 1657 CDS 100% 10.800 7.560 N CYP4F11 n/a
4 TRCN0000064204 GCCAGACTGGACATGTTTGAA pLKO.1 1017 CDS 100% 5.625 3.938 N CYP4F11 n/a
5 TRCN0000064207 CGCAGGAAACCCGAGCTGATA pLKO.1 1953 CDS 100% 1.650 1.155 N CYP4F11 n/a
6 TRCN0000423722 CCTTGCAAAGCACCCAGAATA pLKO_005 1487 CDS 100% 13.200 6.600 Y CYP4F2 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2994 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021187.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08771 pDONR223 100% 99.7% 99.6% None (many diffs) n/a
2 ccsbBroad304_08771 pLX_304 0% 99.7% 99.6% V5 (many diffs) n/a
3 TRCN0000481046 ATCCATTACTGGGAGATGTCCCCC pLX_317 25.3% 99.7% 99.6% V5 (many diffs) n/a
4 ccsbBroadEn_07253 pDONR223 100% 88.5% 86% None (many diffs) n/a
5 ccsbBroad304_07253 pLX_304 0% 88.5% 86% V5 (many diffs) n/a
6 TRCN0000477423 CCTAGGAGTTGTCCATAAAGAAGC pLX_317 25% 88.5% 86% V5 (many diffs) n/a
7 ccsbBroadEn_08896 pDONR223 100% 86.8% 82.8% None (many diffs) n/a
8 ccsbBroad304_08896 pLX_304 0% 86.8% 82.8% V5 (many diffs) n/a
9 TRCN0000467927 CCTCCCATATTCTGTTCTGTTGAC pLX_317 28% 86.8% 82.8% V5 (many diffs) n/a
Download CSV