Transcript: Human NM_021239.3

Homo sapiens RNA binding motif protein 25 (RBM25), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
RBM25 (58517)
Length:
6813
CDS:
188..2719

Additional Resources:

NCBI RefSeq record:
NM_021239.3
NBCI Gene record:
RBM25 (58517)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021239.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074750 GCGCCTTAAGAATTGGGAAAT pLKO.1 1564 CDS 100% 10.800 15.120 N RBM25 n/a
2 TRCN0000286633 GCGCCTTAAGAATTGGGAAAT pLKO_005 1564 CDS 100% 10.800 15.120 N RBM25 n/a
3 TRCN0000074749 CCAGGCTTAAAGGCTAAAGAA pLKO.1 401 CDS 100% 5.625 7.875 N RBM25 n/a
4 TRCN0000074752 CGTCGAATTAGACCATGGATT pLKO.1 2492 CDS 100% 4.950 6.930 N RBM25 n/a
5 TRCN0000294109 TCATCACTAAGGAGGATATAA pLKO_005 960 CDS 100% 15.000 10.500 N RBM25 n/a
6 TRCN0000294061 GGTGAAGAAGAAGCTACATTA pLKO_005 2537 CDS 100% 13.200 9.240 N RBM25 n/a
7 TRCN0000294108 TTATACTCACCAGGTACAAAT pLKO_005 2920 3UTR 100% 13.200 9.240 N RBM25 n/a
8 TRCN0000074748 CGGCAATTTGTAAGTTTACAT pLKO.1 3757 3UTR 100% 5.625 3.938 N RBM25 n/a
9 TRCN0000074751 GCTGGATGAATGGAAAGCAAA pLKO.1 691 CDS 100% 4.950 3.465 N RBM25 n/a
10 TRCN0000215487 GATAGTGTCTTTAACAAATTC pLKO.1 2261 CDS 100% 13.200 9.240 N Rbm25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021239.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03868 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03868 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491757 ATTTTAAGCGGTCCTGGTTAACCA pLX_317 17.7% 100% 100% V5 n/a
Download CSV