Transcript: Mouse NM_022983.4

Mus musculus lysophosphatidic acid receptor 3 (Lpar3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Lpar3 (65086)
Length:
2494
CDS:
209..1273

Additional Resources:

NCBI RefSeq record:
NM_022983.4
NBCI Gene record:
Lpar3 (65086)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022983.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127284 GCGTCAAATATGAGCACGATT pLKO.1 1802 3UTR 100% 4.950 6.930 N Lpar3 n/a
2 TRCN0000127285 GCTTACGTGTTCCTGATGTTT pLKO.1 452 CDS 100% 5.625 3.938 N Lpar3 n/a
3 TRCN0000127286 TCCCATTTACAGTAGGAGTTA pLKO.1 748 CDS 100% 4.950 3.465 N Lpar3 n/a
4 TRCN0000127288 CTAACTTAGCTGCTGCGGATT pLKO.1 417 CDS 100% 4.050 2.835 N Lpar3 n/a
5 TRCN0000127287 GAAGACAGTGATGACCGTCTT pLKO.1 922 CDS 100% 0.405 0.243 N Lpar3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022983.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489572 TATCCTGTTATTGTAACTTCGCAC pLX_317 38% 84.6% 91.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489136 TACCTGTCTAAGAGGGGCAGCTTA pLX_317 30.5% 84.6% 90.9% V5 (many diffs) n/a
3 ccsbBroadEn_07907 pDONR223 99.8% 84.5% 90.9% None (many diffs) n/a
4 ccsbBroad304_07907 pLX_304 0% 84.5% 90.9% V5 (many diffs) n/a
5 TRCN0000476780 GTGCCTCATCAACCGGTTTTGGGT pLX_317 37.9% 84.5% 90.9% V5 (many diffs) n/a
Download CSV