Transcript: Human NM_024041.4

Homo sapiens sodium channel modifier 1 (SCNM1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
SCNM1 (79005)
Length:
1913
CDS:
10..702

Additional Resources:

NCBI RefSeq record:
NM_024041.4
NBCI Gene record:
SCNM1 (79005)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024041.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005676 AGTCAACTCAATGTGCTCAAA pLKO.1 40 CDS 100% 4.950 6.930 N SCNM1 n/a
2 TRCN0000280240 AGTCAACTCAATGTGCTCAAA pLKO_005 40 CDS 100% 4.950 6.930 N SCNM1 n/a
3 TRCN0000126943 GAGTCAACTCAATGTGCTCAA pLKO.1 39 CDS 100% 4.050 5.670 N Scnm1 n/a
4 TRCN0000326533 GAGTCAACTCAATGTGCTCAA pLKO_005 39 CDS 100% 4.050 5.670 N Scnm1 n/a
5 TRCN0000280241 AGACGAGCCCTGGACCATTAT pLKO_005 568 CDS 100% 13.200 6.600 Y SCNM1 n/a
6 TRCN0000005674 GCTAACTCAGACACGACTTAT pLKO.1 327 CDS 100% 13.200 6.600 Y SCNM1 n/a
7 TRCN0000280296 GCTAACTCAGACACGACTTAT pLKO_005 327 CDS 100% 13.200 6.600 Y SCNM1 n/a
8 TRCN0000005675 CAAACTCCAAAGTGGGAAGAT pLKO.1 462 CDS 100% 4.950 2.475 Y SCNM1 n/a
9 TRCN0000005672 GCCAGTTACATTCCAGAGGAT pLKO.1 85 CDS 100% 2.640 1.320 Y SCNM1 n/a
10 TRCN0000280294 GCCAGTTACATTCCAGAGGAT pLKO_005 85 CDS 100% 2.640 1.320 Y SCNM1 n/a
11 TRCN0000005673 CGCCGGAAGTACAGACCAGAA pLKO.1 394 CDS 100% 1.350 0.675 Y SCNM1 n/a
12 TRCN0000280239 CGCCGGAAGTACAGACCAGAA pLKO_005 394 CDS 100% 1.350 0.675 Y SCNM1 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1118 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1118 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024041.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04020 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04020 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470429 TGTATACAGTGCAGACGAGCGACC pLX_317 61.6% 100% 100% V5 n/a
Download CSV