Transcript: Mouse NM_024431.3

Mus musculus mortality factor 4 like 1 (Morf4l1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Morf4l1 (21761)
Length:
1896
CDS:
246..1217

Additional Resources:

NCBI RefSeq record:
NM_024431.3
NBCI Gene record:
Morf4l1 (21761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024431.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295575 CGAGGAAATACAGATAATAAA pLKO_005 855 CDS 100% 15.000 7.500 Y Morf4l1 n/a
2 TRCN0000238605 TCGAGGAAATACAGATAATAA pLKO_005 854 CDS 100% 15.000 7.500 Y Gm4835 n/a
3 TRCN0000239889 CAGAAAGCAGAGTACTCAAAT pLKO_005 418 CDS 100% 13.200 6.600 Y Morf4l1b n/a
4 TRCN0000239891 CATGAACAGAGTTGAAGTTAA pLKO_005 695 CDS 100% 13.200 6.600 Y Morf4l1b n/a
5 TRCN0000238604 GAGACCACAGTACGCTGAAAT pLKO_005 959 CDS 100% 13.200 6.600 Y Gm4835 n/a
6 TRCN0000071527 GCGCCACATTTGCTGAGATTA pLKO.1 1023 CDS 100% 13.200 6.600 Y Morf4l1 n/a
7 TRCN0000288265 GCGCCACATTTGCTGAGATTA pLKO_005 1023 CDS 100% 13.200 6.600 Y Morf4l1 n/a
8 TRCN0000239887 GTCATTCCTTAGGCATCTTAT pLKO_005 1673 3UTR 100% 13.200 6.600 Y Morf4l1b n/a
9 TRCN0000107583 GTGTGTAAAGGTTGCCATAAA pLKO.1 332 CDS 100% 13.200 6.600 Y MORF4L1 n/a
10 TRCN0000300199 GTGTGTAAAGGTTGCCATAAA pLKO_005 332 CDS 100% 13.200 6.600 Y MORF4L1 n/a
11 TRCN0000307582 TAGTCCTTCTCTTGTACAAAT pLKO_005 1273 3UTR 100% 13.200 6.600 Y Morf4l1 n/a
12 TRCN0000239890 GTGAAATACTTCATCCATTAC pLKO_005 363 CDS 100% 10.800 5.400 Y Morf4l1b n/a
13 TRCN0000238606 TGAGATTATTTGTGCGAATTG pLKO_005 1036 CDS 100% 10.800 5.400 Y Gm4835 n/a
14 TRCN0000107582 GTTGCCATAAAGGACAAACAA pLKO.1 342 CDS 100% 5.625 2.813 Y MORF4L1 n/a
15 TRCN0000071525 CCTTGCTTTATTACTGAACTA pLKO.1 1094 CDS 100% 4.950 2.475 Y Morf4l1 n/a
16 TRCN0000288202 CCTTGCTTTATTACTGAACTA pLKO_005 1094 CDS 100% 4.950 2.475 Y Morf4l1 n/a
17 TRCN0000071524 GCCTCTTCTCTATGAAGCAAA pLKO.1 311 CDS 100% 4.950 2.475 Y Morf4l1 n/a
18 TRCN0000071523 GCTGAGATTATTTGTGCGAAT pLKO.1 1034 CDS 100% 4.050 2.025 Y Morf4l1 n/a
19 TRCN0000298416 GCTGAGATTATTTGTGCGAAT pLKO_005 1034 CDS 100% 4.050 2.025 Y Morf4l1 n/a
20 TRCN0000071526 CCTGCCAAGAAGAATGTGGAT pLKO.1 798 CDS 100% 2.640 1.320 Y Morf4l1 n/a
21 TRCN0000218744 GAAACAGCGAGAACTTCAATA pLKO_005 458 CDS 100% 13.200 6.600 Y EG546908 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024431.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02566 pDONR223 100% 90.7% 100% None (many diffs) n/a
2 ccsbBroad304_02566 pLX_304 0% 90.7% 100% V5 (many diffs) n/a
3 TRCN0000468389 GCTCCCCGGTCGGACCGAAGGCAC pLX_317 38.5% 90.7% 100% V5 (many diffs) n/a
4 ccsbBroadEn_14059 pDONR223 100% 64.8% 72.4% None (many diffs) n/a
5 ccsbBroad304_14059 pLX_304 0% 64.8% 72.4% V5 (many diffs) n/a
6 ccsbBroadEn_15732 pDONR223 0% 64.8% 72.4% None (many diffs) n/a
7 ccsbBroad304_15732 pLX_304 0% 64.8% 72.4% V5 (many diffs) n/a
8 TRCN0000472961 ACCCGGTGTCATGCCACGCTAAAA pLX_317 76.3% 64.8% 72.4% V5 (many diffs) n/a
Download CSV