Transcript: Human NM_024662.3

Homo sapiens N-acetyltransferase 10 (NAT10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
NAT10 (55226)
Length:
3973
CDS:
180..3257

Additional Resources:

NCBI RefSeq record:
NM_024662.3
NBCI Gene record:
NAT10 (55226)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308219 CGGCCATCTCTCGCATCTATT pLKO_005 2707 CDS 100% 13.200 18.480 N NAT10 n/a
2 TRCN0000035703 GCAATTGTACACAGTGACTAT pLKO.1 653 CDS 100% 4.950 3.960 N NAT10 n/a
3 TRCN0000307142 GCAATTGTACACAGTGACTAT pLKO_005 653 CDS 100% 4.950 3.960 N NAT10 n/a
4 TRCN0000035701 CCACAGGAAATTCACACCGTA pLKO.1 2178 CDS 100% 2.640 2.112 N NAT10 n/a
5 TRCN0000296354 AGGGCCCTCCTTTCCTATAAG pLKO_005 3518 3UTR 100% 13.200 9.240 N NAT10 n/a
6 TRCN0000035702 CGCAAAGTTGTGAAGCTATTT pLKO.1 2877 CDS 100% 13.200 9.240 N NAT10 n/a
7 TRCN0000296355 GAGATGTATTCACGGAATATG pLKO_005 2655 CDS 100% 13.200 9.240 N NAT10 n/a
8 TRCN0000296411 TTGCTGTTCACCCAGATTATC pLKO_005 2065 CDS 100% 13.200 9.240 N NAT10 n/a
9 TRCN0000035700 CGAGCTGGATTTGTTCCTGTT pLKO.1 2352 CDS 100% 4.050 2.835 N NAT10 n/a
10 TRCN0000035699 CCAGTCTCTAAATCCTGAATT pLKO.1 1211 CDS 100% 0.000 0.000 N NAT10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03554 pDONR223 100% 99.9% 99.9% None 1381T>C;1686C>T n/a
2 ccsbBroad304_03554 pLX_304 0% 99.9% 99.9% V5 1381T>C;1686C>T n/a
3 TRCN0000467973 GCACGAATCGTCGTTATCGTATGG pLX_317 12.6% 99.9% 99.9% V5 1381T>C;1686C>T n/a
4 TRCN0000489921 GGAAGCGGACCGCAAGTAAAATCC pLX_317 15.2% 99.9% 99.9% V5 (not translated due to prior stop codon) 1381T>C;1686C>T n/a
5 TRCN0000489299 TGTGGATGATTATCAGCCCCGTGT pLX_317 12.7% 99.9% 99.8% V5 1381T>C;1686C>T;3075_3076insG n/a
Download CSV