Transcript: Mouse NM_026055.2

Mus musculus ribosomal protein L39 (Rpl39), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Rpl39 (67248)
Length:
434
CDS:
96..251

Additional Resources:

NCBI RefSeq record:
NM_026055.2
NBCI Gene record:
Rpl39 (67248)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424956 AGCGATTCCTGGCCAAGAAAC pLKO_005 124 CDS 100% 10.800 5.400 Y Rpl39 n/a
2 TRCN0000104110 CAATGGCAAGACTGAGGATTT pLKO.1 261 3UTR 100% 10.800 5.400 Y Rpl39 n/a
3 TRCN0000104114 CCTCAGTGGATCCGGATGAAA pLKO.1 165 CDS 100% 5.625 2.813 Y Rpl39 n/a
4 TRCN0000117635 CGATTCCTGGCCAAGAAACAA pLKO.1 126 CDS 100% 5.625 2.813 Y RPL39 n/a
5 TRCN0000333551 CGATTCCTGGCCAAGAAACAA pLKO_005 126 CDS 100% 5.625 2.813 Y RPL39 n/a
6 TRCN0000104112 GAGAACGAAGCTGGGTCTGTA pLKO.1 230 CDS 100% 4.950 2.475 Y Rpl39 n/a
7 TRCN0000104111 TCAGGTACAACTCTAAGAGAA pLKO.1 199 CDS 100% 4.950 2.475 Y Rpl39 n/a
8 TRCN0000427061 GATTCACACAATGGCAAGACT pLKO_005 253 3UTR 100% 3.000 1.500 Y Rpl39 n/a
9 TRCN0000104113 ACAACTCTAAGAGAAGACACT pLKO.1 205 CDS 100% 2.640 1.320 Y Rpl39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01440 pDONR223 95.9% 89.5% 100% None (many diffs) n/a
2 ccsbBroad304_01440 pLX_304 0% 89.5% 100% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_04718 pDONR223 100% 86.2% 92.1% None (many diffs) n/a
4 ccsbBroad304_04718 pLX_304 0% 86.2% 92.1% V5 (many diffs) n/a
5 TRCN0000471064 TAACGGACTGCAAGGTTGAAGAAC pLX_317 100% 86.2% 92.1% V5 (many diffs) n/a
Download CSV