Transcript: Mouse NM_026353.4

Mus musculus solute carrier family 48 (heme transporter), member 1 (Slc48a1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc48a1 (67739)
Length:
2526
CDS:
117..557

Additional Resources:

NCBI RefSeq record:
NM_026353.4
NBCI Gene record:
Slc48a1 (67739)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026353.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190184 CACGTGATGTACATGCAGGAT pLKO.1 282 CDS 100% 2.640 3.696 N Slc48a1 n/a
2 TRCN0000216501 CCTTTCCAAATAGATCTATTT pLKO.1 794 3UTR 100% 1.320 1.848 N Slc48a1 n/a
3 TRCN0000202318 GCAGAAATACAGCGGCCATTT pLKO.1 1614 3UTR 100% 10.800 8.640 N Slc48a1 n/a
4 TRCN0000292746 GCAGAAATACAGCGGCCATTT pLKO_005 1614 3UTR 100% 10.800 8.640 N Slc48a1 n/a
5 TRCN0000201145 CAGCATCCTTAGTGATTTCTA pLKO.1 536 CDS 100% 5.625 3.938 N Slc48a1 n/a
6 TRCN0000292747 CAGCATCCTTAGTGATTTCTA pLKO_005 536 CDS 100% 5.625 3.938 N Slc48a1 n/a
7 TRCN0000189474 CAAAGACCCGAACAGCTACTA pLKO.1 425 CDS 100% 4.950 3.465 N Slc48a1 n/a
8 TRCN0000292744 CAAAGACCCGAACAGCTACTA pLKO_005 425 CDS 100% 4.950 3.465 N Slc48a1 n/a
9 TRCN0000190335 CTGGAGCTTCATTTCCTTCAA pLKO.1 458 CDS 100% 4.950 3.465 N Slc48a1 n/a
10 TRCN0000201891 CTTGGTGACTCACGTGATGTA pLKO.1 272 CDS 100% 4.950 3.465 N Slc48a1 n/a
11 TRCN0000292672 CTTGGTGACTCACGTGATGTA pLKO_005 272 CDS 100% 4.950 3.465 N Slc48a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026353.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03622 pDONR223 100% 90.1% 92.4% None (many diffs) n/a
2 ccsbBroad304_03622 pLX_304 0% 90.1% 92.4% V5 (many diffs) n/a
3 ccsbBroadEn_12240 pDONR223 100% 54.3% 54.7% None (many diffs) n/a
4 ccsbBroad304_12240 pLX_304 0% 54.3% 54.7% V5 (many diffs) n/a
5 TRCN0000465396 ATGTGTGAGAATGTTATACCAGTC pLX_317 100% 54.3% 54.7% V5 (many diffs) n/a
Download CSV