Transcript: Mouse NM_026879.2

Mus musculus charged multivesicular body protein 2B (Chmp2b), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Chmp2b (68942)
Length:
1838
CDS:
190..831

Additional Resources:

NCBI RefSeq record:
NM_026879.2
NBCI Gene record:
Chmp2b (68942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241156 GACAAGAACGTTCGCTGTAAG pLKO_005 405 CDS 100% 10.800 15.120 N Chmp2b n/a
2 TRCN0000241153 GCCATTAGGCGTCAACGTAAA pLKO_005 1158 3UTR 100% 10.800 15.120 N Chmp2b n/a
3 TRCN0000191824 GCCTTAAATAGCACGAACATA pLKO.1 1423 3UTR 100% 5.625 7.875 N Chmp2b n/a
4 TRCN0000241155 GATGGCCAAGATTGGTAATAA pLKO_005 333 CDS 100% 15.000 10.500 N Chmp2b n/a
5 TRCN0000241154 TCCACTTCAAAGGCTACAATT pLKO_005 763 CDS 100% 13.200 9.240 N Chmp2b n/a
6 TRCN0000241152 TGACTGAAGAAATGATCAATG pLKO_005 599 CDS 100% 10.800 7.560 N Chmp2b n/a
7 TRCN0000201218 GTCCACACAAACGAAAGTGAT pLKO.1 444 CDS 100% 4.950 3.465 N Chmp2b n/a
8 TRCN0000191514 GATGAAGAGATTGAACGTCAA pLKO.1 787 CDS 100% 4.050 2.835 N Chmp2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07972 pDONR223 100% 89.6% 99.5% None (many diffs) n/a
2 ccsbBroad304_07972 pLX_304 0% 89.6% 99.5% V5 (many diffs) n/a
3 TRCN0000479680 TCCGGCCTACTACTCTTCTAATAC pLX_317 64.1% 89.6% 99.5% V5 (many diffs) n/a
Download CSV