Transcript: Mouse NM_027758.4

Mus musculus TBC1 domain family, member 9 (Tbc1d9), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d9 (71310)
Length:
5149
CDS:
724..3819

Additional Resources:

NCBI RefSeq record:
NM_027758.4
NBCI Gene record:
Tbc1d9 (71310)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027758.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087769 GCTCAGATGATGAGGTGTATT pLKO.1 1277 CDS 100% 13.200 18.480 N Tbc1d9 n/a
2 TRCN0000087770 CCGTACCGAATCCTTTATCAA pLKO.1 907 CDS 100% 5.625 7.875 N Tbc1d9 n/a
3 TRCN0000087768 CGAAGTACTTTAGTGAGACTT pLKO.1 4238 3UTR 100% 4.950 3.960 N Tbc1d9 n/a
4 TRCN0000087772 CCCAGCTTTCCAGAACGAAAT pLKO.1 1737 CDS 100% 10.800 7.560 N Tbc1d9 n/a
5 TRCN0000087771 GCTCTGTAAGACCATGTACAA pLKO.1 3117 CDS 100% 4.950 3.465 N Tbc1d9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027758.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07845 pDONR223 99.8% 70.8% 77.8% None (many diffs) n/a
2 ccsbBroad304_07845 pLX_304 0% 70.8% 77.8% V5 (many diffs) n/a
3 TRCN0000479305 GCAAACTTTAATGTTCCAACAGAT pLX_317 11.5% 70.8% 77.8% V5 (many diffs) n/a
Download CSV