Transcript: Mouse NM_027874.2

Mus musculus casein kinase 1, delta (Csnk1d), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Csnk1d (104318)
Length:
3749
CDS:
324..1553

Additional Resources:

NCBI RefSeq record:
NM_027874.2
NBCI Gene record:
Csnk1d (104318)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149348 CGGAGACATCTATCTCGGTG pXPR_003 AGG 76 6% 1 -0.1191 Csnk1d CSNK1D 76716
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027874.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322351 ACCAAATGATAAGTCGTATTG pLKO_005 652 CDS 100% 10.800 15.120 N Csnk1d n/a
2 TRCN0000361898 CGAGAACGGAAAGTGAGTATG pLKO_005 1416 CDS 100% 10.800 15.120 N Csnk1d n/a
3 TRCN0000023772 GACCAAATGATAAGTCGTATT pLKO.1 651 CDS 100% 10.800 15.120 N Csnk1d n/a
4 TRCN0000322284 TCTATCTCGGTACGGACATTG pLKO_005 391 CDS 100% 10.800 15.120 N Csnk1d n/a
5 TRCN0000023770 GCAAGGGCTATCCTTCTGAAT pLKO.1 1045 CDS 100% 4.950 3.960 N Csnk1d n/a
6 TRCN0000322349 ATTTGCCACATACCTGAATTT pLKO_005 1064 CDS 100% 13.200 9.240 N Csnk1d n/a
7 TRCN0000322285 GGATCGAGAAGAACGATTAAG pLKO_005 1250 CDS 100% 13.200 9.240 N Csnk1d n/a
8 TRCN0000322282 ATGGCTGATCTACTCTGTTAC pLKO_005 1670 3UTR 100% 10.800 7.560 N Csnk1d n/a
9 TRCN0000361946 CTCTGTTACCAATGGCTTTAC pLKO_005 1682 3UTR 100% 10.800 7.560 N Csnk1d n/a
10 TRCN0000361907 TCGTATTGAGTACATTCATTC pLKO_005 665 CDS 100% 10.800 7.560 N Csnk1d n/a
11 TRCN0000023771 CCTCACAGAATAGCATTCCTT pLKO.1 1513 CDS 100% 3.000 2.100 N Csnk1d n/a
12 TRCN0000023769 CCTGAATTTCTGCCGTTCCTT pLKO.1 1076 CDS 100% 3.000 2.100 N Csnk1d n/a
13 TRCN0000010640 GTCCACCTCACAGAATAGCAT pLKO.1 1508 CDS 100% 3.000 2.100 N CSNK1D n/a
14 TRCN0000279937 GTCCACCTCACAGAATAGCAT pLKO_005 1508 CDS 100% 3.000 2.100 N CSNK1D n/a
15 TRCN0000194725 CCAATGGCTTTACTAGTGACA pLKO.1 1690 3UTR 100% 0.000 0.000 N CSNK1D n/a
16 TRCN0000023773 CGGGATCGAGAAGAACGATTA pLKO.1 1248 CDS 100% 10.800 6.480 N Csnk1d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027874.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00378 pDONR223 100% 90% 99.7% None (many diffs) n/a
2 ccsbBroad304_00378 pLX_304 0% 90% 99.7% V5 (many diffs) n/a
3 TRCN0000467149 GTTCAACACCCCCACCGCCAACGT pLX_317 16.9% 90% 99.7% V5 (many diffs) n/a
4 TRCN0000487781 TATCAACCTAAGCCATCACCAAAC pLX_317 17.1% 90% 99.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000487884 GTGCGCCGACGAAGTCCCGTACGG pLX_317 16.7% 89.9% 99.5% V5 (many diffs) n/a
6 ccsbBroadEn_06056 pDONR223 100% 87.2% 95.2% None (many diffs) n/a
7 ccsbBroad304_06056 pLX_304 0% 87.2% 95.2% V5 (many diffs) n/a
8 TRCN0000479473 AGTTACCGTGACGGCATGCCTGAA pLX_317 18.4% 87.2% 95.2% V5 (many diffs) n/a
9 ccsbBroadEn_14600 pDONR223 0% 87.2% 95.2% None (many diffs) n/a
10 ccsbBroad304_14600 pLX_304 0% 87.2% 95.2% V5 (many diffs) n/a
11 TRCN0000479372 TAGGCGTCATCTCCCTCATAAACC pLX_317 18.4% 87.2% 95.2% V5 (many diffs) n/a
12 TRCN0000488055 CATAGAACCCGCCGCCGAGCCGTC pLX_317 17.5% 87.2% 95.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV