Transcript: Mouse NM_030145.3

Mus musculus LSM6 homolog, U6 small nuclear RNA and mRNA degradation associated (Lsm6), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Lsm6 (78651)
Length:
3702
CDS:
117..359

Additional Resources:

NCBI RefSeq record:
NM_030145.3
NBCI Gene record:
Lsm6 (78651)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_030145.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204568 CGGCCAGTTGTGGTGAAATTA pLKO.1 168 CDS 100% 15.000 21.000 N Gm10043 n/a
2 TRCN0000243447 CCATTGGTTGATTACGTATTC pLKO_005 638 3UTR 100% 10.800 15.120 N Lsm6 n/a
3 TRCN0000204367 CCGAGGAAACAATGTGCTGTA pLKO.1 311 CDS 100% 4.050 3.240 N Gm10043 n/a
4 TRCN0000187052 CTGGATGGCTACATGAATATA pLKO.1 225 CDS 100% 15.000 10.500 N Gm10043 n/a
5 TRCN0000243448 GTTTCAGCCTTGGGCTATAAA pLKO_005 774 3UTR 100% 15.000 10.500 N Lsm6 n/a
6 TRCN0000243449 TTTGTTTCTCCAGGATTATTT pLKO_005 592 3UTR 100% 15.000 10.500 N Lsm6 n/a
7 TRCN0000243450 ACTCACCATCCGTACCATTTA pLKO_005 728 3UTR 100% 13.200 9.240 N Lsm6 n/a
8 TRCN0000243451 CTTACCCTCCTTCAATCTAAA pLKO_005 1250 3UTR 100% 13.200 9.240 N Lsm6 n/a
9 TRCN0000187459 GAACAGACAGAGGAGTATGTA pLKO.1 252 CDS 100% 5.625 3.938 N Gm10043 n/a
10 TRCN0000186862 GCTGTACATAAGTACACAGAA pLKO.1 326 CDS 100% 0.495 0.347 N Gm10043 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030145.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02633 pDONR223 100% 92% 100% None (many diffs) n/a
2 ccsbBroad304_02633 pLX_304 0% 92% 100% V5 (many diffs) n/a
3 TRCN0000473537 AGCGTGGCTAAGTCTAATTGTTAA pLX_317 100% 92% 100% V5 (many diffs) n/a
Download CSV