Transcript: Human NM_030787.4

Homo sapiens complement factor H related 5 (CFHR5), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
CFHR5 (81494)
Length:
2814
CDS:
110..1819

Additional Resources:

NCBI RefSeq record:
NM_030787.4
NBCI Gene record:
CFHR5 (81494)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030787.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371730 GTGTTGAGTCTACTGCATATT pLKO_005 1434 CDS 100% 13.200 10.560 N CFHR5 n/a
2 TRCN0000371778 TGTTGCAACACACCAACTTAA pLKO_005 1075 CDS 100% 13.200 9.240 N CFHR5 n/a
3 TRCN0000153472 CAATCTGTCAGGAAGGGAAAT pLKO.1 1776 CDS 100% 10.800 7.560 N CFHR5 n/a
4 TRCN0000151038 GCAGTTAAGTTTCCACGTAAA pLKO.1 2412 3UTR 100% 10.800 7.560 N CFHR5 n/a
5 TRCN0000151515 CGTGACTTAATCACCTTCTAA pLKO.1 2362 3UTR 100% 5.625 3.938 N CFHR5 n/a
6 TRCN0000152699 GCAAAGGACAAGTACGATCAT pLKO.1 711 CDS 100% 4.950 3.465 N CFHR5 n/a
7 TRCN0000152813 GCAGCTTCACTAAAGGAGAAT pLKO.1 528 CDS 100% 4.950 3.465 N CFHR5 n/a
8 TRCN0000152731 CTACAAAGTTGGAGACGTGTT pLKO.1 601 CDS 100% 4.050 2.835 N CFHR5 n/a
9 TRCN0000153473 CATGCAAAGGACAAGTACGAT pLKO.1 708 CDS 100% 3.000 2.100 N CFHR5 n/a
10 TRCN0000371729 AGGGTGTCTTAGTCCATATTA pLKO_005 2009 3UTR 100% 15.000 9.000 N CFHR5 n/a
11 TRCN0000151727 CCAGTGTAAATTCCCACATAA pLKO.1 1726 CDS 100% 13.200 7.920 N CFHR5 n/a
12 TRCN0000160718 CGCATAACATGCACAGAAGAA pLKO.1 314 CDS 100% 4.950 2.475 Y CFHR1 n/a
13 TRCN0000162838 CAGAAGAAGGATGGTCACCAA pLKO.1 327 CDS 100% 2.640 1.320 Y CFHR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030787.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04233 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04233 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474102 GCCCAGTTGCTACTTTCGATTTCC pLX_317 21.3% 100% 100% V5 n/a
4 ccsbBroadEn_00735 pDONR223 100% 39.4% 34.6% None (many diffs) n/a
5 ccsbBroad304_00735 pLX_304 0% 39.4% 34.6% V5 (many diffs) n/a
6 TRCN0000475488 CCGCGAATTTATTCCGGCGTGAGA pLX_317 49.8% 39.4% 34.6% V5 (many diffs) n/a
Download CSV