Transcript: Mouse NM_031170.2

Mus musculus keratin 8 (Krt8), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Krt8 (16691)
Length:
1805
CDS:
104..1576

Additional Resources:

NCBI RefSeq record:
NM_031170.2
NBCI Gene record:
Krt8 (16691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031170.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305933 CTCCGAGATGAACCGCAACAT pLKO_005 1042 CDS 100% 4.950 6.930 N Krt8 n/a
2 TRCN0000091877 GCAGATTAAATCCCTGAACAA pLKO.1 400 CDS 100% 4.950 3.960 N Krt8 n/a
3 TRCN0000091876 TGAAACCATGTACCAGATTAA pLKO.1 955 CDS 100% 13.200 9.240 N Krt8 n/a
4 TRCN0000305999 ACGTCTGTGGTGCTGTCTATG pLKO_005 845 CDS 100% 10.800 7.560 N Krt8 n/a
5 TRCN0000305998 AGCGTACAGAGATGGAGAATG pLKO_005 675 CDS 100% 10.800 7.560 N Krt8 n/a
6 TRCN0000091875 CCCTGGCTTCAGCTACGGAAT pLKO.1 1417 CDS 100% 1.350 0.945 N Krt8 n/a
7 TRCN0000325588 CCCTGGCTTCAGCTACGGAAT pLKO_005 1417 CDS 100% 1.350 0.945 N Krt8 n/a
8 TRCN0000091874 CCAGATTAAGTATGAGGAATT pLKO.1 967 CDS 100% 0.000 0.000 N Krt8 n/a
9 TRCN0000325589 CCAGATTAAGTATGAGGAATT pLKO_005 967 CDS 100% 0.000 0.000 N Krt8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031170.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10940 pDONR223 100% 49.1% 50.6% None (many diffs) n/a
2 ccsbBroad304_10940 pLX_304 0% 49.1% 50.6% V5 (many diffs) n/a
3 TRCN0000467772 ACAAATATGTCAAGAGTTCTGACC pLX_317 14.7% 49.1% 50.6% V5 (many diffs) n/a
4 ccsbBroadEn_12931 pDONR223 100% 20.4% 16.6% None (many diffs) n/a
5 ccsbBroad304_12931 pLX_304 0% 20.4% 16.6% V5 (many diffs) n/a
6 TRCN0000471683 GTTCGCATTGACTCGACCACCATG pLX_317 100% 20.4% 16.6% V5 (many diffs) n/a
Download CSV