Transcript: Human NM_031477.5

Homo sapiens yippee like 3 (YPEL3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
YPEL3 (83719)
Length:
1601
CDS:
732..1205

Additional Resources:

NCBI RefSeq record:
NM_031477.5
NBCI Gene record:
YPEL3 (83719)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031477.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243057 CGGATCTAGCTCCTGTATATA pLKO_005 1316 3UTR 100% 15.000 21.000 N YPEL3 n/a
2 TRCN0000243056 GAACTCAACCACATGATCAAA pLKO_005 1167 CDS 100% 5.625 7.875 N YPEL3 n/a
3 TRCN0000172555 GATGATTGTCACCGGAGGTAT pLKO.1 888 CDS 100% 4.950 3.960 N YPEL3 n/a
4 TRCN0000243055 AGAGCAGCCAGAAGTACAAAG pLKO_005 1129 CDS 100% 10.800 7.560 N YPEL3 n/a
5 TRCN0000243053 GAGAACTGCAAGACCACTTTG pLKO_005 1083 CDS 100% 10.800 7.560 N YPEL3 n/a
6 TRCN0000243054 TCAGGCCTACTTGGATGATTG pLKO_005 875 CDS 100% 10.800 7.560 N YPEL3 n/a
7 TRCN0000191128 CAACCACATGATCAAAGACAA pLKO.1 1172 CDS 100% 4.950 3.465 N Ypel3 n/a
8 TRCN0000277395 CAACCACATGATCAAAGACAA pLKO_005 1172 CDS 100% 4.950 3.465 N Ypel3 n/a
9 TRCN0000172387 CAGGCCTACTTGGATGATTGT pLKO.1 876 CDS 100% 4.950 3.465 N YPEL3 n/a
10 TRCN0000166935 GAAGTACATCATTGAACTCAA pLKO.1 1154 CDS 100% 4.950 3.465 N YPEL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031477.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12753 pDONR223 100% 78.1% 78.1% None 0_1ins132 n/a
2 ccsbBroad304_12753 pLX_304 0% 78.1% 78.1% V5 0_1ins132 n/a
3 TRCN0000472105 CCTAACTGAAGGGCCTCCGCGATT pLX_317 81.5% 78.1% 78.1% V5 0_1ins132 n/a
4 ccsbBroadEn_16023 pDONR223 0% 75.7% 75.7% None 1_114del n/a
5 ccsbBroad304_16023 pLX_304 0% 75.7% 75.7% V5 1_114del n/a
6 ccsbBroadEn_08123 pDONR223 100% 60.8% 66.2% None (many diffs) n/a
7 ccsbBroad304_08123 pLX_304 0% 60.8% 66.2% V5 (many diffs) n/a
8 TRCN0000472132 TTCAACAATTGAGCCTCATAACTA pLX_317 100% 60.8% 66.2% V5 (many diffs) n/a
Download CSV