Transcript: Human NM_032092.2

Homo sapiens protocadherin gamma subfamily A, 11 (PCDHGA11), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
PCDHGA11 (56105)
Length:
4232
CDS:
178..2430

Additional Resources:

NCBI RefSeq record:
NM_032092.2
NBCI Gene record:
PCDHGA11 (56105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032092.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413128 ATGTTTACACAGTCCGTATAT pLKO_005 901 CDS 100% 13.200 18.480 N PCDHGA11 n/a
2 TRCN0000053260 GCGCGATTTGCTCTTCCTAAT pLKO.1 628 CDS 100% 10.800 15.120 N PCDHGA11 n/a
3 TRCN0000053259 GCCCTACAATCCTTCGACTAT pLKO.1 1726 CDS 100% 4.950 6.930 N PCDHGA11 n/a
4 TRCN0000427580 TGGTCCAGAGCTACAATATAA pLKO_005 1421 CDS 100% 15.000 10.500 N PCDHGA11 n/a
5 TRCN0000053262 CCTCGATGTAAATGATCACAT pLKO.1 876 CDS 100% 4.950 3.465 N PCDHGA11 n/a
6 TRCN0000053258 GCTCTTCTAAATGTGCAAGAT pLKO.1 1279 CDS 100% 4.950 3.465 N PCDHGA11 n/a
7 TRCN0000053813 CCAGCCATAAACCAATAACTA pLKO.1 3331 3UTR 100% 5.625 2.813 Y PCDHGA2 n/a
8 TRCN0000203363 CCCAAGATCAATGCTCAAGTT pLKO.1 2976 3UTR 100% 4.950 2.475 Y PCDHGA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032092.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01151 pDONR223 100% 17.4% 16.8% None (many diffs) n/a
2 ccsbBroad304_01151 pLX_304 0% 17.4% 16.8% V5 (many diffs) n/a
3 TRCN0000466539 CATGGTTCGGTAATGAAAGTTCCA pLX_317 36.4% 17.4% 16.8% V5 (many diffs) n/a
4 ccsbBroadEn_11019 pDONR223 100% 8% 8% None 1_2070del n/a
5 ccsbBroad304_11019 pLX_304 0% 8% 8% V5 1_2070del n/a
Download CSV